Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12191  (registered. 2002)
Contig Information
Length 1303 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09956 [Oryza sativa Indica Group] >gi|125584867|gb|EAZ25531.1| hypothetical protein OsJ_009014 [Oryza sativa (japonica cultivar-group)]
Score 552
Evalue 1.90202e-150
Total Hit Count 300
Registered year 2002
Contig Sequence     [ Download ]
>Contig12191
gaggaattcggcacgaggcgacttatgcgcgccttccgcgacccctcgcgccctacatgggcaacaccatctgcgagatccaggtcggcatgggccccgc
cggcgagctccgctacccctcctacccggagagcaacggcacctggtccttccccggcatcggcgagttccagtgctacgaccgctaCATGCGCGCCAGC
CTCAAGGCCGCcgccgAGGCGGTGGGCAGGCCCGAGTGGGGCAACGCCGGCCCCGAGGACTCGGGCAGCTACAACCAGTGGCCAGAGGACACCGGCTTCT
TCCGCCGCGAGGGCGGCTGGAACACcggacTACGgccagtTCTTCATGAGTTGGTACTCGCAGatgctgatcgagcacggcgagcggatactctccgcct
gctcctccgtcttcacgggtacccctggggtcaaggtctccgtcaaggtggccggcatccactggcactacggcacccgctcccacgcgcccgagctcac
cgccggctactacaacaccaggaaccacgacgggtacctgcccatcgcgcgCATGATCGGTCGCCACGGCGCCGTGCTCAACTTCACCTGCGTCGAGATG
CGCAACCACGAGCAGCCGCAGGACGCGCAGTGCATGCCCGAGGCGCTCGTGAGCcaggtggccagcgCCGCCAagggagGCCGGAGTGGGCCTCGCCGGG
GAGAACGCCCTACCCAGGTACGACGAGACGGCGCACGACCAGGTGCTGGCCACCGCGGCGGAGAAGGCTGAGGAGGACCGCATGGTCGCCTTCACCTACC
TTCGCATGGGCCCCGACCTCTTCCAGCCCGACAACTGGCGCCGCTTCGCCGCGTTCGTCAAGCGCATGACGGAGACCGGCGTCAGGGACGTGAGCCGGGA
GCAGGTGGAGCGCGAGGCTCAGGGCGTCGCCCACGCCACCCAGGGCGTCATCCAGGAGGCCGCCGTCGCCCTCTGCAACTAATCAACTATGCATTACATA
CATACGTACCGTGATGATCGAAGGTGTGTACCGAATGAAGGTGGGAAGGAAACGTAGGGGGATCGATCGATCGATCGGGTGACTTGGGAGTAGTTGCCGC
GCCTGAAGCTTCGATGGCATGGCGATGCCGGTTTCGGCGTCGCTACCTCAAAGCTTGCAGAGGACTGATGTACTACTACGTACTAAGCTGCCGCAGTAGC
ATGTTGCACTGTAAGATCGATACTCGAAAATGTTGTAACG*CCTTGCTGTATCTGTTCCACTAAAgtgaaatgaagaacagagcttggcgagcaaaaaaa
aaa
page-top