Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12189  (registered. 2002)
Contig Information
Length 713 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cell wall beta-glucosidase [Secale cereale]
Score 845
Evalue 8.23733e-89
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig12189
acacgacaacatccgCAAGAACGCATCGCTCTTTTATTGCTAACATAACAAATCAACCACAAAACTCAATGTATGTATGTATCCCATCTCTCACAGCCCA
GCCGAGATAGTACATCCCATCTCACCCGAGTACCCGACTCACTTGTTGGCCTCGGTGGTGAGGCCGAACCCGAAGGGGAAGAGCGGGTCGTAGTGCTTGT
CGCCGACGTTCATCGGCAGCTGGTCCACCGACTTGAACCACGTCCTCGCCAGCTTCCCGGAGAACCCGTAGTCGCCGAAGAGCGCGTCGGCCACGCCCTG
GCCCTCGGAGCCGGGCAGCCACGCGGCGACGAACGCGTCCATGGCGCCAATGTACGGCTCCAGCACCAGCGGCCTGCCGGAGATGAGCACCACCACGCAC
TTGACGCTCTTGCACACGCTCTGGATCACCGAGGGACCCGGGGCAGGGATCGTCAGGTTGAGGTTGTCGCCGAACGTCTCGGCGTAGGGCGGCTCGCCGA
CCACCACGATGGCATAGTCATACTTGCCGCTGTCCACGGCGGCGCTGTCCGGGTTCTCCGAGAAGACCACCTCCGTGCTGGGGTCGACGGTGGACTTGAT
CGCCGAAAGGATCGTCGTCCCGGCAGTTTTGTCGTTGCCGGTCTGTCCTTGCCATGTGATGGTCCATCCTCCGCACTGGAGGCCCAAGTCATCGGCGTGG
CTT*CcgGCGacc
page-top