Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12148  (registered. 2002)
Contig Information
Length 698 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 3
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hsc70-interacting protein [Zea mays]
Score 270
Evalue 3.43602e-22
Total Hit Count 271
Registered year 2002
Contig Sequence     [ Download ]
>Contig12148
ttttttttttcagctGTAAAGTCTTCTCTGCcaaatATATAAACAGGG*AACTGTCGCATCATCTCGGTAAAACCCTCAAGCATCCGCAGACTGTCAGCC
ACCGCAG*GTTCGCTACCACTACTTACTACCAACATGTAATAAAAAGCCAGGCATGACATATCCCACATCCAACAAGCGT*****CTC*****TGCGCGC
TAGTATCGCCAACCGACAACACACGCATGTCTCTCGATGCC*AAAAAGACACTGCCAACACTTAACCAGAgTTTTTTTT*G*TCCTGCTGAT***CGCAA
AAAC**C*GTCGGTCACGAGGGC*****C*CATGGGGCGATCACCGGTTCCCGTTCATCTTGGCCATCATCTTGGCTATGATGGGCCCCACCTTGGGGTT
CGCCTGGTGCTTGGCCAAGTTGGCAGGGTTGCTCATCACATCTTGAAGGGCCGCCATAACCTCTGGGTCACCAAATGCTGCCATCAGGTCAGGGTCATTC
AAGATGTCACCCATATCAACATTaccaggagcacctccaGCTCCAGGCATACCACCTCCCATTCCTctaccaccccccaTTCCAGGCATaccgcctCCCA
TTCCTGCGGGCATACCGCCCCCCATTCCTGCGGGCATACCTCCACCCATTCctccagggaaaccaccccccattcctccaggcataccacccatacct
page-top