Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12079  (registered. 2002)
Contig Information
Length 684 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_f Spike at flowering date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14427 [Oryza sativa Indica Group]
Score 654
Evalue 1.05317e-66
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig12079
ttttttttttaaaatcaatttactaataatttattactcttctcaagctcagctaggcaaaatagtttcaacATGGCATTCACCGTGAAGCGGTACCAAA
TAGACAATAGAACAGGTCATCATTACCCATTACACACCATGATTTCTTCCTCCTTAAGGTGCCACACTTCTCTCCCCTGGCAAAACAATCACCACGCCCC
TAAAATTGCATGCTGCCCCCAGGTTGCTACCGTATCGTTGCGCTTCTACATCATACCCTGGGGCATCCCGGCAGGCGCGGGGGCCTTCTTGCTAGGCTTC
TCCACGACGATCGCCTGGGTGGTCAGGACCATTCCGGCCACCGACGCCGCGTTCTGCAGGGCGCACCTCGTCACCTTCGCGGGGTCGATGACTCCAGCCT
CAACCAGGTTCTCGTGCTTGTCGGTCATCGCGTTGTACCCAAACTCCCACTCGCTGTCCTTGATTTTTTCCACGATCACCTCCCCTTCGACTCCGGCATT
GTGCGCTATCAATGATGCCGGTGCCACCAGAGCCTTCTGAATGATATCAGCACCGAGGCGCTCCTCAGGGTCATCCAGCTTCTCCTTGATGGCTGGTACG
AATGTCGACAGGTGAACATAGGCCGCACCACCTCCAGGTACTATACCTTCCTCAAtgg*ccgCAAAA*G*TTGCATTCTTGGca
page-top