Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12064  (registered. 2002)
Contig Information
Length 1024 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03702 [Oryza sativa Indica Group]
Score 1186
Evalue 4.51767e-128
Total Hit Count 172
Registered year 2002
Contig Sequence     [ Download ]
>Contig12064
cccccactgcTCCGGATCCACCtcccacaTTGCTTCCAGGCCGCCAGATTCGTCCGAATCCGGCGCTTGCCCCGCCGGAGGGCTCGATCTGGCCCCGGAT
CGACCGGCATTCCGGCCCCGTGCACGCTCCAGTCCCGGCGGTGAGGCATGGGGACCTTCGGTGGCCAGTTCGAGGACTTCCATGCGGACGACCGGCGTGC
GGAGGTGATAGATTGGCTCGGCGGGCTGCTGCCGGAGTTCGATTTGCCGCTGGATTCTTCAGACGAGGAGCTGCGGGAGTACCTTATTGACGGAACGGCG
CTGTGCTACACTGCGGACAAGCTCATGCCTGGTGTTCTGGAGGGGGTTTGGGGTGGTTATGCATCAGACCATCGGTCAAATGTGAAGAAGTTCCTCTCTG
TTATCGCGGAGATGGGGCTGCCAGGATTCAGCGTCAAGGATCTTGAGGAGGGATCAATGTCGTCTATAGTAGAGTGTCTCTTGGCTCTAAGAGATAATGT
GTCAGCAGGATTGGGTGAAAATATGTCTAACTATGCTGCTAAGACTCCTCCAAGGCCTGTGGCTCCAGTTTCCACACCAGGAAGGAGATCTCCtggagaG
GATAGAAGAAGGGGTCTTTGGGACgctaaatCCCCACAAAGAAGTCCACTTCTTTCAGGACAGAAGGCcaacgaGGTTTTCCAATTTAAGCGCGGACAAT
ACACAGATCTTCCTGCTGCTAAGATTTCAGAGATGATCCAGTCAAACAGTTTAGATAATGCCCCtactcaatcacttcttagagttgttaacggcattct
ggatgaaagcattgagagaaaaagaggagaaataccacatcgagttgtttatttactaaggaacgttgttcaagagattgagcaccgcatttctattcaa
gcagaacacattagaaatcaaaatagcatcatcaaaacacgcgaggataagtaccgttcaaaaattaaagcactcgagacattagtaaatggaacaaatg
aagaaaacgagatggcaataaacc
page-top