Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12050  (registered. 2002)
Contig Information
Length 769 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 956
Evalue 1.29025e-101
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig12050
ttttttgctcacaagtttattcatttaACAGATCGACATAAGTAGCATTATTCCATGAAACAGCTTCGTATTCTTCACCTTAAACTCTGGCAAGTTCCAT
*CCGATAAAAATGAAGAAAAATATCAGTCCCCAAGCATCAAATAGACTGGCACAACAGACCATGCTAACAGTTTACACAGTTACAGTGGCTTCGACCTCT
TGCAGTCTGAGGGTAACAGCTCGCTTGTGCGCTTCTAGCCCTTCGACTTCTGCCATCTTTGCGACGTAGGGGCCCAGCCTTCTCAGCCCTTCTTCAGTCA
GGGATTGAACAGTGATGTACTTGAGGAAAGAGTTCAGCGACACACCGCTGTACATCCTCGCGTAACCGTAGGTTGGGAGGACGTGGTTCGTCCCACTGGC
ATAGTCACCCACGCTCTCGGGGGTCCATTGTCCCAAGAAAACTGACCCTGCGTTCTCGATGAGCTCCTCCCATTGCTCAGCATCCTTTACGTTGATGATC
AAATGCTCAGGAGCATACATATTTGAGAACGATAATGCCTCAACCATATCTCTGGCAAACACAGTGAAACTGTGGCCAAGTGCTTTGGAAGCAAAGTCGC
CTCTAGGAAGAGCATCGCACTGCTTGCTAACTTCTGCTTCAATGGCACCTAAATCAACACCATctccaGCAATAACTAGAACAACCTGACTATCTGGGCC
ATGTTCTGCCTGagatagcagatcagcggcaacatgaactgggttggcatatttgtcagcaattaccag
page-top