Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4917  (registered. 2012)
Contig Information
Length 1803 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_RDr Root of dessiccated seed 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1724114|gb|AAB68030.1|| Af10-protein [Avena fatua]
Score 682
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4917
CAGTGTTCAATGTAATGTTGATGGTTTCCGAAGTAGTATTTCAGAAACCCAGGAATTGAATGCAAGCACCGCAAAGCATTACAGAAGCAAAAGGGCCTAC
AATTTACAGAAGGTGCACATATTAAACATAAGATTGAATCGAATCATGATGTGACACAAGGGCAGCGTATCTGCAAACCCGACAAACACAACACATGCTT
GACAACACTGGACAAAGACCACGATACTTGAATACTGCAGCAATTACAAGCAATGTGACCGTCAACAAAAGCGAGGTGACAAAACCAATAAAAAGATAAT
AAGCGCCCAAAGGCACAGTCCAGCAAAAGCAACAAACACCAGGTGCTAGAAATGTTCTCCTATGGAGCTCATTTGAAGCCACCAAACTGATACTTGTTGT
AGTTTGCCAAGCTCTCGATGCCACCGCCTTGCGTAGACGGAGGAATTCCAGACATTCCTAGGCCAGATCCCCCTGCACCCATGTTCCATGAGGGTTGGCC
AGATCCTCCGGCACCCATGTTCCATGAGGGTTGGCTAGATCCTCCGGTCCATGAGGATTGAGCCTTGTCGTCGAACCCATCACTAAGGCCGCCAACAACC
CCAACATCGGCTAAGTTCACCTTCTTTGGTCCAGTTATGTTCAGATCAATCAATCCACGGCTCAAAGAGTCAGCCCATATGCCAGATTTGACCTGAAAAT
TTTCTTTCTTGGTGTTGGGCTTGGGAGCTGCCAAAGGTGTTTGGTCTGCCCTTCCATTAATACTTGAAGAAAGATCAAAGGGGTCTTTAGCTGCTTCTTG
AGTGTTTGCAACGAAGGCACCAAAATCAGAGGCACCAGTTTTGGGAGCAGCCAAAGGTGCTACATCTGCTTTGCCAAAATTGCCAGTGGAAGAAAAGTCG
AAGGGGTCTTTAGCTGTATCCACGGTGTTTGATTCAAAGGCACCAAAGTCCGATGCTGCCTCAAGGTTCTGACTTGACGTGCTGATATTTCCAGTGGAGC
TGTGTACAGGTGGTGGTGGTGCACTAGAGGTGCTGAAGTCACCAAATGGGTCAGATCCCCCAAAACTGCTTAAAGGAATATCACCGAAAGGATCAAATGG
TTCAGGTACTGTGTTCTTGGACACGGAAGTATTAGCATTAGAAGATGTCCCAGAAGTTGGTGGTGGGATAAACCCAGTCTGTGGTGGAAATGCTGAAGCA
AAGGTTGCATTTCCCGAAAAAAGGTCAACAGTTTCCTGGACATCCTGATGCGCAGCTGTTTCGGCACCTGGGATTGCCGATTGGAAATCTGCATCAGCAA
ACAGATCAACCGGAGGTTCTGCAGCACTTTCTGTTGCTGGAGTGGCTGCGGGCTCGCCAAGGAAATCATCCATCAAATTTGGGCCAAGAAGATCCGCCTC
AGCAGTCTTTGTATTAGCTGCACCGTTTGAGGAAGATCCACGAGGATCAAAGTCATCGAATTCATCCTCATTGCCTTTGGTGTTAGATGGGGACTTCGAG
GAGCTTCTATCATGATCCGCGTCCTTTCTTATCTTGCTGCCAGATTTGCGCCTGCCAGTACTACTTGAAGAGGTTTTAACAGGTTCTTTGTCCCTGTAAC
TGTTACTGAACGAATCAGCCTCCCTTGTGCCACCAAAACTGCCATAGCGTTCACCTGAACTGTAGTTGCTACCTCCAGAGGCTGAGCTTGATCTGTATGA
CCCGGTTGATGATAACCCAACGTACTTGTCACGGTTACTGGCCGCTTTCTCTCTCACAGCCTTTATTCTCTCCTTATCATTGATGATTCCCACCAGAGTT
TCC
page-top