Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig12031  (registered. 2002)
Contig Information
Length 928 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Proteasome subunit beta type 3 [Oryza sativa Japonica Group] >gi|215768995|dbj|BAH01224.1| unnamed protein product [Oryza sativa Japonica Group]
Score 998
Evalue 2.43221e-106
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig12031
gcctcgtgccgaatcggcacgaggccgaccagcagcggcggcgaccccctcccctcctccttccccaaatcgaacccggcgccccccgtccccggcgacc
ccgcgactccggccggccatgtcgatcttcgagtacaacggctccgcggtggtggcgatggtggggaagaactgcttcgccatcgccagcgaccgCCGCC
TCGGCGTGCAGCTGCAGACCGTCGCCACCGACTTCCAGCGGGTCTTCAAGATCCACGGCAAGCTCTACATCGGCCTCTCCGGCCTCGCCTCCGACGCCCA
GACGCTGTACCAGCGGCTCGTGTTCAAGCACAAGCTGTACCAGCTGCGGGAGGAGCGCGACATGAAGCCCGAGACCTTCGCCAGCCTCGTCTCCTCCATG
CTCTACGAGAAGAGATTTGGGCCGTACTTCTGCCAGCCAATTATTGCTGGACTTGGACAGGACGACGAGCCATTTATTTGTACCATGGACTGCATTGGTG
CAAAGGAACTTGCTAAGGATTTTGTTGTCTCAGGGACAGCATCAGAGTCCCTATATGGTGCTTGTGAATCCATGTACAAACCCAACATGGAACCCGAGGA
ACTCTTCGAGACCATATCACAAGCCCTGTTGTCTTCAGTTGATCGCGATTGCCTCAGTGGGTGGGGAGGCTATGTTCTAATTGTGACACCGACCGAAGTT
CAAGAGCGGGTGCTCAAGGGCAGGATGGACTAGATTATGCATGGCCTAGAATTCGTCAGCCGCTTTCCGATGCTTCTACGCATGCTGTTTCAGCATCCCT
GTTGTGCCCTGGTTCCAGAGTAACCTTGTACTGTCAAACTGATGGTGTTATATTTGCCCGTAGAAAAgaacatttgttgtcttcttatttctgctttcta
tcaatggtgagacatctctgtcacgtgc
page-top