Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4912  (registered. 2012)
Contig Information
Length 923 bp
Clones alternative view 23 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 3
Wh_VSCB Liquid cultured tissue 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|6683765|gb|AAF23357.1|AF109194_1|AF109194_1 glutathione-S-transferase [Hordeum vulgare subsp. vulgare]
Score 417
Evalue 1.00E-114
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4912
TTTTTTTTTTGAAGTTCAAATATACCCTTTATTAATTTATTCTTCACACATGAAATAGAATCGCAGGTGGCAACTCGGTGCTGCCCCAACTGAAGAAGAC
GCGTTGACATACACACACACACACAGACGCGTCACAAGTACACGACCAAGCAACAACTACTACGTACCACCAATGACCGTACACACGATCGAACTTATTG
CTTCCCCCCGGCCGGCCGGTCGGCTTACTCGACGCCGTGCATCTTCTTGAGCACGCCGATGAACTCGTAAATCTTGTCAGGCGAGTAGAGGCTCTTGGCG
ACGCTCTCCCGCTCGCCGCACCGCTTTGCCCACGCCGCGATCTTCGGCGCCACCTCCGCCACGCTGAACTCGCCGTACTTCTCGTAGCTGTGGAACCACG
ACGTGAAGGGCGCGAACGCGGCGTCGACGAACCCGAAGGCATCGCCGCCGAAGAAGGACTTATCCCCGAGCGCCCCGTCCAGATTCTTGAGGATTTCCAC
CATCTCGGCCCGCGCCTGCGCGTGCGGCTCGCCCTTGAGCTTCCAGAGCCGGGTGCCGCAGTCGTAGACCTTCTTGTCGACGTAGTCGGCCCAGAAGCGA
GCCTGCGAGCGCTCGTAGGGGTCGGAGGGGAGGAGGGACGGGGTGTCCGGGAAGGCGTCGTCGAGGTAGTTGAGGATGATGAGAGACTCGTTGACGGGGC
GGCCGTCGTGGAGGAGCACTGGGATCTTCTTGTGGATGGGGTTGGAGCGGAGGAGGCGGTCGCTCTTGCCGGCCATGAGGTTCTCTTCGACGTACTCGTA
GGGGAGGCCTTTTTCTGCAAGAGCGATGAGGCAGCGCTGCCCGAACGGGCTCACCCAGAAGTTCAGCAGCACCAGACCCTTCTCGCCCGCCATTGCTGTT
GAGTTTGTGTTGGGTCAATCGAC
page-top