Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4901  (registered. 2012)
Contig Information
Length 1532 bp
Clones alternative view 60 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 2
Wh_DPA20 Seed DPA20 2
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 4
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 3
WH_XB Root 5
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|283777738|gb|ADB28898.1|| 26S protease regulatory subunit-like protein [Lolium perenne]
Score 820
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4901
TCACATTTTCGGCACAGAGTACAGGCACAAAGCAAGAGTGCTTCACACAATCAGGAGGATTCGAGAATTAAACTATATTCCAAATAAAAATGGTAGCCGA
GTGTTACAAACAGAGGTCATCACTGGACCAAGCGTTCTGATTACTCAAGGGAAACTAAGCGTAATAATTCAAGCTGGACTTCTTCTTTGCTTGCACTTGG
ATAATGCCTTCGTTGAAATCTTCATGGATCACCTCTGTAGCGTCCCTGCGTAGAGCAAGCATGCCAGCTTCCACACAAACAGCCTTCAGCTGTGCACCGT
TGAAATCATCAGTTGAACGAGCCAGCTCCTCAAAGTTGACATCAGGATGTACGTTCATCTTCCTTGAGTGAATTTGCAAAATCCGAGCTCTTGCTTCTTC
CGTCGGATGAGGGAACTCGATCTTCCTGTCCAGGCGACCAGAACGGAGTAAAGCAGGATCAAGAATATCTGCACGATTGGTTGCAGCTATCACCTTTATC
CTCTCATCACTGCTAAATCCATCTAGCTGATTCAGCAACTCCAACATAGTTCGTTGCACTTCTCTGTCACCACTCACTTCACTGTCAAAACGCTTTGTTC
CAATTGCATCAATTTCATCAATAAAAATGATGCAGGGGGCCTTCTCCTTTGCCAGCTCAAAGGCATCTCGGACAAGCTTTGCCCCGTCACCGATGAACAT
CTGGACTAACTGCGGACCAGCAAGTTTCAGAAAGGTTGCATTGGTTTGTGCAGCACATGCACGAGCCATCAATGTCTTCCCCGTCCCAGGTGGTCCATAT
AAAAGAACTCCTTTCGGGGGACGGATTCCCAACTTCTGAAATTGCTCCTTGTGTGTCATTGGCAACACTATAGCTTCAACGAGTTCCTGAATCTCTTTCT
CAAGGCCACCAATGTCATTATAATCCTCCGTAGGCTTTTCATCTACCTCCATTGCCTTTACTCGAGAGTCATACTCCGAAGGTAGCGTGTCTAATATCAA
GTAGCTGTCCTTGTTGACTCCAACCAAATCACCAGGCTTGAGGTTGTCAGGGTCAACTAGCCCGATCACAGGAAGGAATATAGTCTGTCTTGTGGATGTC
TTAAGAACAACACATTTTCCTTTCCTCTGTGAGTCCAGATCTATATTAGCACCATCCTCTTCAGCCTCATCTTCAGGGTTCATTTCCAAAATCTCGACGA
TGTTGCCGACGAGGTAGGGCAGCTGCTTGTTGAGCTTTATTTTCTCCTGATTCTCCTTGATCTTGTCCTTGACGTTCTCGAGCTCCAGGTTGTTCCGCTG
CAGCTCGTCCTTGAGGACGCGGACCTCGTTGTCGAGGAGGCGGGTGGCCCGGACGATGTCCTCCGTGGACATGGAGTCGAGCTGGTCGGTCTCCGACGAG
TCGTCGACGGCCATCGCGGCGGCGCCGGCGTCTGGCGCGGGGGTAGGGGAGGACGACATGGCGCTCTGCTGCGGCCGGGGAGGGGAGGGGAGGCGGAGAT
TTGTGGGAGGTTGCGGCCTCGTGCCGAATTCC
page-top