Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4899  (registered. 2012)
Contig Information
Length 837 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_RDr Root of dessiccated seed 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115453441|ref|NP_001050321.1|| Os03g0402000 [Oryza sativa (japonica cultivar-group)]
Score 366
Evalue 1.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4899
CAGTTTATTCCAAAAAGATTTAGCATTTAATCAGAGTAAAAGCACTTCATTTCCACGCACTGTTCCAAAGTAGGAAAGCCATATAAGATCTCTACAATAC
ATCTGCGGTACACATTGCAGCTGCAAAATACAATGCACAGGTGCCTCATGTAAAACATGACGGCTGTACCAGAATTACACCCACAGGGAAAGCAAAACGG
ATATCCAGACAAGCAAACAAGCGCCACCGTGCGGAAGAGCTACCCTTTGAGATGAAACTAATCATCATCCTTGTAGGGGTATTCCTCTGGGACTTGCTTG
GTGAGCTTCACCCGCATCTCGTAGGCGTCGTCCCCACGAAGCATGTCGCGGACCCATGTAACCTCCGTCTTCATGGAAACCATTTCCAGTGCTCCCCTGA
TAACTCCACTCAATACATTGCAATACTGAAGGCCTTGGCAAGTATCAGGAAGTTCAACAAAATCTACAAGTGGGTTGTCCTCCAATACAAAGCTGCAAGT
TGTACCCTCAGCATCCCAATTGGTTACAGTCGCAGTCACACCCAGGAACATTTTGAACCCAAGCTTTGCTATAGTATCAGCAGTCTCCTTGAAGTCAGCA
CAGTTTGATACATTTGACTTGGCTAAGAATTCATCGACCAACCGAGTTCCAATATTGTAACCCATCTGATCGAGCTGCTTGTTGACCTCCTCGACCTCTT
CGAGATCCGTGAGCAGCTGCCGCACGATGGCGCCGTACGTGAGCGTGAAGAGCTCGGCGTTTACGCGCTCGACGCTGGCGAAGAGGGCGTCGCCGGACTT
GGGGGTCGTGAGAGGCGGCATCGCCGAGATCGGGGCC
page-top