Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11796  (registered. 2002)
Contig Information
Length 739 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_026567 [Oryza sativa (japonica cultivar-group)]
Score 186
Evalue 2.3057e-12
Total Hit Count 4
Registered year 2002
Contig Sequence     [ Download ]
>Contig11796
cgcgacttaatatctTAATAatnaatTCGGTACAGCACTGag*cgACTGCGGCTCGTCTTTGCGCTGATACAGATAGAACTAACTGTGCGCTTACGTGCG
CAGCAGCTATGTCCGGGCCGAATCTTCCGTAAACAAGAACAGAAATTGGCACTAGTAAACTAGTAGGTAGATCAGGTAGGCAACATAACTACAGGTTTCC
ATACAGAACCAATGGTGTGCTTACAAAATATCATCAACGGGCGACTGCAGCAGAACCCTTCACGTCGAACGGAGATCCCAACGGCGCGATCAGGCCCAGG
CTCTGCATGATCTTGATCTGGCGCACGCTACGCTGCTCCGATCCCCCCGCGCCCAGGAGAAGAGTTGGGGTCCTTGGTCTCCGGCTTTGCCGCCTTGCCC
TTTCTAGGTTTCTTCTTCGCAGCACGGCTTGAGTCAGCCTCCAGCCCACTAGCGGCCCGCTTGGTGCTTAGTCCACCCTCTGTCTCAGTAGTAGTAGCAG
CAGTCGCCTTTGCCTCGGTAGCTTCACAGATTCCAAAGATCACTTCATCCACATATGCCATTTCAGCAGCAAGCTGCCTGTCTATGACGTCCCCCAGCAG
TATATCCCTGACCATAGCTTTTATCTTCCGGTGGGTTCCTTCGACCGTCAAACCAGTTTTGTGCTGGCTTCGATTCACGGATGTCATGTCTCCTGCTTCA
GCTGCATTTTCACTTGCGcttgaaacatggagctgtgac
page-top