Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11773  (registered. 2002)
Contig Information
Length 957 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_oh Pistil at heading date 1
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit immediate-early protein RSP40 [Zea mays]
Score 127
Evalue 2.52096e-05
Total Hit Count 10
Registered year 2002
Contig Sequence     [ Download ]
>Contig11773
gcGAAATTTTCTCGCGagnagTTCGTGTGTAGTAGAGGAGTTGAGGAGATGAAGCCGGCGGTTGAAGGTGACGAGCGTGCGGCGGAGATCGCCCGCATCA
AGGCTGCCGCGGCCGCCGCCAAAAAGGCGGCGGAAGAGGTGGTGGATGTGGACGATGAGGGTGAGGACGACGAGGGAGATGAGGAGGAGGAGGCGGTTGA
CGGCGACGACGACGACGACGACGACGAAGTCGACGACGATGGGGAAGAGGACGAGGACGAGGGGGTGGAGGGTGAGGATAAGGGGTCGGCGGCGCAGCAG
GTGGTCGACATCTCCGACGAGGACGACGACGGCGGTGATGAAGAGGAGGGCGGTGACGA*TGATGACGACGACGACGACGACGACGATGACGAGGAGGAT
GACGACGAAGTCGACGAGGAGGAAGAGCCCGAGGAGGAGCTAGGAACTGAATATCTGGTGCAGCCGCTTGGCCGTGCTGAAGACGAAGAGCATTCCAGTG
ACTTCGAGCCAGAAGAAAATGGTGATGGTGCTGAGGACGAGGAGATTGAGGATGACGATGCTGAGGATGGTGAGGATCCTGTCAAGGCGCAATCCTCATC
AAAGAGGAAGAGGTCTGGTGGGGAGGATGAAGATGATGACGACGGTGATGATGATGGTGATGATGATGAGAAGCCTCCATCAAAGCGATAGTCAATTT*G
TTCGTGCTGATCTGTGATCTTCTCTGCTTGGGCCAAGAAGGAAAATAATCCTCATGGAGAGGATTGTTGGTAAATGCTGTAGCTTTAGGACATCTGTGGT
AGGTGTAGCAGCTCAAACTTGAGTCTACCCATGTTAGTTGTTAGTGcatactgctgatgttgattaacagcctccgggaacttctgtatgagcattagat
atggggcttgttatatgcttgtgtagcttcnattaaaacctttggaatgtggatgct
page-top