Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11619  (registered. 2002)
Contig Information
Length 614 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 269
Evalue 3.6528e-22
Total Hit Count 96
Registered year 2002
Contig Sequence     [ Download ]
>Contig11619
ttttttttttccctgccagtCTTAAAAATATATTTCTGGT*CCTTCGTACTGCAGTTTACGATGGATACTGG*AG*ATGGGAAGTACAGTATGCTGTAGC
AGCTATATGGCGCATACAACACACTTCTAAACTACCGTACAGAATAGCCTAGCCTTACAGTACATACTGCTAAAATAGAACACACGATACAGATTGGCTA
CTACCAGTACACGCAAATAAAGTAAGAGACACGTCATCGCCATACATAGTTCAGTGGTGTTGAAGGAGAGGGCATGTCACGCTAGGAAGCCGTTG*ACTG
CATGCGTCGGTGCGGTGCTTTTAGCCGTTAGGCGATGTCGATGGAGCGGACGTTGCGCTGCTTCTGGGCTTGCTCGTCCTTGGGCACGACGACCCTGAGC
ACGCCGTCCTGCATGGTGCACCGGATGCCGTCCGCCTTGGCGTCGTTTATGGTTGAGACTAGGACGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTT
CTTGATTAATGAAAACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGAATTTCACCTCTGACTATGAAATACGAATGCCCCCGA
CTGTCCCTATTAac
page-top