Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11595  (registered. 2002)
Contig Information
Length 1314 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_22171 [Oryza sativa Indica Group]
Score 1448
Evalue 2.69036e-158
Total Hit Count 43
Registered year 2002
Contig Sequence     [ Download ]
>Contig11595
aggaattcggcacGAGGGAGAACTTTGATTTTCTATCTGTAACTGGTGGAGATGTTGCTGGAGGAACTACTGGGCAACTTGAATTGTTATCTACCGCTAT
CATGGATGGATGGATGGCTGGCCTTGGTACAGCGCAGCCCCCAAGCACTGATGCTCTAGGCCAGCTGTTATCTGAGTACAGCAAGCGTGTTTACACATCA
CAGCTACAACACTTGAAGGACATAGCTGGCACATTGGCAACAGAGGAGGCTGATGATCCTGTTCATGTCAGTAAGCTGCGCTCTGCTCTGGAGTCCGTTG
ATCATAAAAGAAGAAAGATCATGCAACAAATGCGGACTGATACTGCCTTGTTAACCAAAGAAGAAGGTGGTTCACCTATCCGAAATCCTCCAACTGCTGC
TGAAGATGCACGATTAGCATCTCTTATATCTCTAGACAACATCTTAAAGCAAGTCAAGGAAGTAATAAAACAAAGCTCTACAAGACCATTACGAAAATCA
AAAAAGAAAGCATTGCTAGAATCATTAGATGACCTATTGGCACAGATGCCTTCTCTTCTTGACATTGATCATCCATGTGCTCAGAAGCAGATCACGGATG
CACACAATGCTGTAGAGTCACTGCAAGAAGACCCCGATGATCCTgcccctgaccccaactcaaattcCAACACGCTGGGAGAGAGCGAAGTTTCGCAGTG
GAACGTATTGCAGTTTAACACTGGAACGACA*GCACCTTTCATCATAAAATGCGGAGCAAATTCGAGCTGTGAACTGGTTATCAAGGCTGATCAACGAGT
CCAGGAACCTAAAGGCGGCGAGGTAATCCGTGTTGTTCCAAGACCATCTGTTCTTGCAGAGATGGGCTTTGAGGAAATGAAAGGTGTGTTTGAGCAATTG
CCAGAAGCAGTCAGCTTGCTTGCCCTTGCACGATCGGCCGATGGCACAAGAGCCAGGTATTCTAGACTGTACAGAACTTTAGCTAGCAAAGTGCCTGCCT
TGAAAGAGATTGTTGCGGAGATGGAGAGAGGTGGTGTTTTCAAGGATGTCAGATCGTAGTGTTAGTTCATTTTGTAGAGTTATATGTAATGTTGTATATG
GATGCCATTTGAGGGCATCACATGTAACCTTTTTTGTTTACACCATGAGCAAGCCTATGTTGTAGCATTGTCTTGGTTTAAGAGAGTTCACCTTGTCTCT
CTGCCTGCCACCCTCTGGATGGTCAATGTTTTAAAATACATGGTTGTTGTAGTTCATTGATGCCCTTGTAATATTAATTATGCCTCTCATTACATACTGC
TAAAGGCATCGctt
page-top