Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11569  (registered. 2002)
Contig Information
Length 709 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08046 [Oryza sativa Indica Group]
Score 133
Evalue 2.97022e-06
Total Hit Count 26
Registered year 2002
Contig Sequence     [ Download ]
>Contig11569
ttttttttttaATTTTAATTTTAGGcttttcaagCGCAGCAGTACATCTGCACCATATGACGCTATAGGCATTATTACCGTCACTACCACGGCAACAACA
TGAACATGCAAAGTTTAAAAAGCTCGCGTACAATAAACTAATAATCCAAAACCTTTTCCCAGCGACTGGTCAGCCCATAGATAACAGTACTAGAAGTTGA
GCTGCGCAAGCGTCACTTGTCTACCCCTCCGACAAGATGAAGTAGATTGCACTCCCAGCTTCAGACTACTACTTGTGGATCGAGCGCCGCTGCGCATCGG
CGCCATCAGCTACCTTTTTTTTCACTTGTAGTCGAACGAAGGTATCGGAGGGCTGGGCGTATCAAAGCTCTCTAATATCTCCGACTTGCCGCCGCTGCCG
CTGGGCTTCTTCTCCTCCTCcttatccttccgcttctcttgaacagatccagatccactacccgccactggagtagtagtggcagcgctttttggtttcc
cgcccaggcctacccttcacagatccatcgccagatttgctcccaacctccttcagcttctggttgctgctgtctttagctaaatcatccttcgtcttgt
tagctgatccagtggctttctccttgccttctttcttaatctcaacggcagttttaggtgtccccttggcatccttgacagcagttttccccttcgattt
gcttggagt
page-top