Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11568  (registered. 2002)
Contig Information
Length 795 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0540800 [Oryza sativa (japonica cultivar-group)] >gi|55908872|gb|AAV67815.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579734|dbj|BAF18097.1| Os05g0540800 [Oryza sativa (japonica cultivar-group)] >gi|218197189|gb|EEC79616.1| hypothetical protein OsI_20813 [Oryza sativa Indica Group]
Score 680
Evalue 1.3863e-69
Total Hit Count 50
Registered year 2002
Contig Sequence     [ Download ]
>Contig11568
cgaattcgataatatgggtGTCCCAGTATTTCTGGAatnagttcaaactCTTGCTCTGCTCTGAATCGtcatgCACATTGCTTTGCACAAAAcagagtTC
ATTTCCAcaaccaACAACAAGGTTAAAACCACCATCAATTCCATTTTACAAAACAGGTGGTGCACGGCTAACCTAGTGTACAAAAGACTAGTCCTATTTT
CCTTGGCCATCGTCCTTCTTGCCCTGGCCCAGGGCCGGCTCTGGTTATTTGGCTACATCCCGATGTTTTATGCTGTGTCCGACTATCAATCAGACGCCTT
CATCTTCCGAGGCCTCTTGCCCTGGGTTGGTGAGGGGGGTGCATCAAATCTTCCAGTGGCCTTCCTCTTGTGGTCCCGTTTGACTGCTCTCTCACCTCCA
AACCCAGCCATATCAGGGACAAAGGGTCGATCAATATCTCTATTAGAACGCTTAGGTGTGGTCGGTGCCTCTGTGAATGAACTTTCTCTGTTTGCTAAAA
CTTCAGCCTCTTTATTTTGTAGCTGCTTCTGTATGTTAAGCAGTGTGAGTATCTCATTCCGTAACTCAAGATGTTCGGCACAAACTGCTTTTGTTGGGAC
CTTAGGCTTCAAATTTACCCCAAGATCTTGTAGAGTTTGATCCACCCTTTTAATCATTCTAATGCCAGCTGAAGCAGTTACTGCTTGAACCATTTGATCA
AGTGCATGGGTTCTCAAATACACTTTAAGCATCCGCAGTGTATCAGGTAT*GGAGGTATTCGCTGCTGCAGCTGGATGTGTAGCAGCTGAAgatg
page-top