Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11567  (registered. 2002)
Contig Information
Length 565 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit avenin-like protein [Triticum aestivum]
Score 334
Evalue 8.52196e-30
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig11567
ggaCCAACGCTGTTGCGCAGTTGGACACTACCTGTAACCAGGGCTCCGAGCAATGTCAGCAGCAGCAACAACCATGGCAACAATGGCAGCAGCAGATGGA
CCCATGTGTGCAATTCCTGCGG*CAGCAATGCAGCACAGTGACACTGCCATTTGTGCAGTCGCGTATGTGGCAACTTAGCAGTTGCCATATAATGCGACA
CCAGTGCTGCCAGCAGCTAGCGCAGATCCCAGAGCAGTTCAGGTGCCGTGCTATTCACAACATGGCTCAAGCCATCATGCAGCCGCAACCCGAGCAATGG
CAGGGTATGTCCCAGTCCCAGCGGCAAGCCCCGCTTGAGGTCATGAGGATGTCGCTTCAGATCTTGCCGTCGATGTGCGGCGTGTACGTCCCGACATACT
GCAACTCCCTACGGCATCCATATGGCCAGAATTGACGGTTGATGGCTCTGTGCAATGTAGTGGTGGCAAAATAAAAGTGGCCTGCATGATCATGCGTGG*
CCTGTACTGTACTAGTTGCAACTTGGAAATAACAAACATCTGCTTCTCAACgaataaaaaaaaaa
page-top