Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11528  (registered. 2002)
Contig Information
Length 1181 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0533700 [Oryza sativa (japonica cultivar-group)] >gi|42761395|dbj|BAD11663.1| cation exchanger-like protein [Oryza sativa Japonica Group] >gi|45735791|dbj|BAD13154.1| cation exchanger-like protein [Oryza sativa Japonica Group] >gi|113624316|dbj|BAF24261.1| Os08g0533700 [Oryza sativa (japonica cultivar-group)] >gi|125604138|gb|EAZ43463.1| hypothetical protein OsJ_026946 [Oryza sativa (japonica cultivar-group)] >gi|215707134|dbj|BAG93594.1| unnamed protein product [Oryza sativa Japonica Group]
Score 981
Evalue 3.26983e-104
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig11528
gcacccttccgatcacacaacggcaccatctagaaaaaaatcacacaccggcgggctcgccgccggccgcctcctctgtcctcttcctgcggcttctcct
gttgcccccacctcccccggcggcctgactcttgactcggccagtagcgaaactccgtctccaagttgtttgccgtacgtccatcctgcgccgcgcgacg
gcgcgccttttcctccccgcttcttcccatcagacagcgtctcctacgcctcctccggtctgcttctctccatagtatttgtcaatcatggtgttcagca
aggtggaagtgaacttgagaaggctgcttgaggcggccccccgccagcagaatcaggctaagcttgtccattacataaccacagccagagagctgttgga
gcagcttggagctgaAATTACACCAGAAGGAATATCAAGTGTTTCAAAAGCTAAGCTCAGTGAGTATTCAGAAAAGATTGAAGCACTAGCTGCCACACTT
GCTTCTCTAGTGCCAGAAAACGAAAATCTGGTTGATGAGAGTAGCGAACAAGACAGCTCTTATGAAAGAGAAAAGGTTGGGAGCCCAATATCCTTATCAT
CAGGATTGCGGAGGAGATCGACGGCTCAGATGG*AGGTTGGACCAAGCAGTCATCAGAGGAAAGAAACAGATACTGGAGCACCTATTAAATTGGATGCAG
AAGCTCAGGCTCACATTGAGAAGCATAGGAAGCTGCAAGAAGATCTAACTGACGAAATGGTTGACTTAGCACGCCAGCTGAAGGAGAGTAGCCTTTTAAT
GAACCAGTCCGTGCAAGATACAGAGAAGATCCTCGATTCCACAGAGAGAGCCGTGGAGCATAGCCTGGCCAGCACCGGCCGTGCAACGGCGCGAGCCTCA
GAGGTCTACTCTCTGGCCTCCAAGACAACCTGCTTCCAGTGGTTGCTCATCTTTTTAATGACGTGCATGTTTGTCATGGTGGTTCTCCTCATACGGATCA
CCTGACATCGCCATGGCGTGTCACCAGTGGCCGCCAAGATAGTACTGCAGTCTTGTAGACAGTCCTTGTACGAAGATAAACTTGAACCTGTGTTCCAGAC
GAGCATTGCTGCTCAACATCGTTATGCAGTTTGctgaagAAAGatgtcccattgggagaatgccatcggctaaaaaaaaaa
page-top