Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11453  (registered. 2002)
Contig Information
Length 762 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0833900 [Oryza sativa (japonica cultivar-group)] >gi|40714681|gb|AAR88587.1| putative deoxycytidine deaminase [Oryza sativa (japonica cultivar-group)] >gi|108711941|gb|ABF99736.1| Guanine deaminase, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113550284|dbj|BAF13727.1| Os03g0833900 [Oryza sativa (japonica cultivar-group)] >gi|215707116|dbj|BAG93576.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218194042|gb|EEC76469.1| hypothetical protein OsI_14201 [Oryza sativa Indica Group]
Score 818
Evalue 1.25444e-85
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig11453
acgaggggcAGACACGCAACAGCCCGACGCGCATCTCGCTCGGGGAGCTCCGCCGCCGATCCGCCCGCCCGCTCGC*CCCCTCACTCGCCCGCCATGGAG
GAAGCCAAGGTTGTGGAGACCAGGGATGGGACTATCGCAGTTGCTTCAGCGTTTCCCGGTCATCAGGAAGCGGTACAAGATAGGGATCACAAGTTCTTGT
CGAAAGCGGTAGAAGAGGCTTACAAAGGAGTTGACTGTGGCCATGGAGGCCCCTTTGGCGCGGTTGTCGTCCGCAACGACGAAGTAATAGTTGGGTGCCA
TAACATGGTTTTGAACAACACCGATCCAACTGCCCATGCTGAAGTCACTGCAATAAGAGAGGCTTGCAAAAAGCTTGGGAAGATTGAGCTGTCGGATTGC
GAAATGTACGCCTCATGTGAGCCTTGCCCAATGTGTTTTGGGGCTGTTCATCTATCCCGGATCAAGAGGCTGGTGTACGGAGCCAAGGCGGAAGCTGCTA
TTGCCATTGGATTCGACGACTTCATCGCTGATGCTCTGAGAGGAACCGGGTTCTACCAGAAGGCCAACATGGAGATCAAGCGAgccgaTGGGAATGGAgc
tctGCTTGCTGAACAAGTCTTTGAGAACACCAAGGAGAAATTCCGAATGTACTAATGTGTAGCAAAGACATGGTAGAATTTCACAGCAtgaaagACCCTG
ATGCTCagaaaaaa***taatgtaattgtcaacattctgtcattggtgaggaccacaaacta
page-top