Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11434  (registered. 2002)
Contig Information
Length 1227 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pox1 [Triticum aestivum]
Score 1385
Evalue 4.94854e-151
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig11434
aggaattcggcacgagggaAAAGTGTGAGGCAGAGGCACCACTTAACATTGTGGTATATTACACTAGCTAGTCGCTAGAGTAGTAGCGATGGCCTCTGCC
TCTTGCCTTGGCTTAGTGGTGCTCGTGGCAATGGCCTCGGCGGCGTCGGCGCAGCTGTCGTCGACGTTCTACGACACGTCTTGCCCCAACGCGCTGGCCA
CCATCAAGGCCGGCGTGACGGCCGCCGTGCAAAACGAGGCCCGCATGGGGGCGTCGCTGGTGCGGCTGCACTTCCACGACTGCTTCGTCGATGGATGTGA
CGGGTCCGTTCTATTGGCGGACACGGGGAGCTTCATCGGCGAGCAGGGGGCAGCCCCGAACAACAATTCCATTCGAGGCATGAACGTCATCGACAACATC
AAGACCCAGGTGGAGGCCGTGTGCAAGCAGACCGTCTCCTGCGCCGACATCCTCGCCGTCGCTGCCCGTGACTCCGTCGTCGCGCTGGGTGGGCCGACAT
GGACAGTTCTTCTCGGGAGGAGGGACTCCACCACTGCAAGCAAGACTAACGCGGAAAATGACCTGCCACCTCCTaccttcGACCTCCAAAACCTCACCAC
CTTGTTCGGCAACAAGCAGCTCAGCATGACAGACATGGTCGCGCTCTCAGGCGCCCACACGATCGGGCAATCGCAGTgccggttcttcAGGGACAGGatc
taCAACGAGACCAACATCGACACTGCCTTCGCGACATCTCTCAGAGCCAACTGCCCCCGGTCCGGCGGCGATAACAGCCTGGCGCCGCTGGACACTGGCA
CGCCCAACGGGTTCGACAACGCCTACTACACCAACCTCATGTCCCAAAAGGGGCTGCTGCACTCGGACCAGGTGCTGTTCAACGGAGGCGGCGCCGACAA
CACGGTCAGGAGCTTCTCGTCCAGCGCCGCGACGTTCAACAGCGCCTTCACGACGGCCATGATAAACATGGGGAACATCGCGCCCAAGACAGGGACGCAG
GGGCAGATCAGGCTCGTCTGCTCCAAGGTCAACTCGTAATCTCCTCGCCGACACTCTTCTGCTACGCATGAACTAAATAAGGTCTTGGAGGCCAGTACCA
GCACCTACGGAGTATCGTGTATGGGGTGGGTGAAAATTGTACCTGTGCATGCGTGCGTCTGTCCACATGTGTAACGAatt*ctCGTGCAAAGGCATGGag
gcatTCCTTTCGTTTatgctCAGTAtg
page-top