Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11371  (registered. 2002)
Contig Information
Length 1106 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11272 [Oryza sativa Indica Group]
Score 952
Evalue 6.89137e-101
Total Hit Count 32
Registered year 2002
Contig Sequence     [ Download ]
>Contig11371
gcCGCAGTTGGAGGTCTGAGTACACCGTATGAACGGGCATCACGTATTCATGAAAGACCAATTGTGAACTGGCTATGGTCTGCTGGATGTCATCCTTTTG
GACCATTCTCAAACTCCTCTCAGATCAGTCAAATCCTTCAGGACGTTGCACTGAGAACTACAATCTATGCCCGGGTTGATGCAGCTCTTCGCAAAATAAG
GGACACATCAGAGTCCGTCCAATCATTTGCGTCAGACCATCTTAAGACGCCATTAGGAGAACCTGTCAAAGGTAATAAAAACAAGTCTAGCACTGAGTTA
TGGGTAGAGAAATTCTATAAGAAGGTGACCACAATGCCGAAGCCTTTCCCCCATGGCCTTGTTGAACGTTTAGAAGAGTACCTGGATAGGCTTGAGGAAC
AACTTGTGGATCTATCTTCATTGCTCTATGACCACCGTCTGGTTGATGCTTCTCAAAACAGTACCGACATCCTTCAGAGCACTATATTTACAGAACAGTA
TGTAGAACGTGTTCTTTCTGCGGAGAGAGACAAGATGGAGTGCTGCAGCATTGAATATAGTCACCCGAAACAGTCATCCCAGGCTTTTGTCTATGGAGGG
ATCCTTCTGGCTGGATTTCTTGTCTACTCATTGGTTATTTTCTTCTCTTCACCAGTTCGATAACTCGCACAACCACTGGATGAAGGCGGTTAAGGATTTT
CTCTATGATGACAAGATGGGTATGTCAAGGACGACGTCTGGTTGAAGCCATGAACTAACGTTGTGTGGTAGACTATTAGTTAGGGCTTGTGTCTTCAAAA
AGAAAAGAAAAGAAATATTAGGGGCTGTCGGATTGTAGCACAATTTTGTCTATGAGATTGTTATTTTTCAGCACTTGAGCCGTAGGAATCTCCATGGCAT
GTACTACCTCCGTATCAAAATAGAATACGTTTTTGTGGGCTAAACTAGCATTCAAAAACGTCTTACTTTTTGCTACGGAGGTAATATCCGATTATCGGCT
CACTTGTCAGTACGCAACGATTTTGATCGTCCCCCCTGCAACTTTGCTACCGCGTAGTATATATGGAGATACTGTACAag*acTATATCACAACCGCCTT
TCAtgg
page-top