Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11351  (registered. 2002)
Contig Information
Length 670 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0338900 [Oryza sativa (japonica cultivar-group)] >gi|54291067|dbj|BAD61743.1| putative eukaryotic translation initiation factor 2B, subunit 3 [Oryza sativa Japonica Group] >gi|54291224|dbj|BAD61920.1| putative eukaryotic translation initiation factor 2B, subunit 3 [Oryza sativa Japonica Group] >gi|113595601|dbj|BAF19475.1| Os06g0338900 [Oryza sativa (japonica cultivar-group)]
Score 815
Evalue 2.18622e-85
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig11351
ttcggcacgaggggaagGAGACGAaccacaAAACCCTGACCTGACCCTCCCCGTCGACCTCATCCGCCGCCGCCGCCGCCGGAGGAGGAGGAGATGGACT
TCCAGGTCGTCGTCCTCGCCGGAGGCACCTCCGAGAAGCTCTCGCCCCTCGTCTCCAAGGACGTTCCCAAGGCCCTCCTCCCCGTCGCCAACCGCCCCGC
GATCTCCTACGTGCTCGATCTCCTCGAGTCCAGCGACCTCAAGGACATCATCGTGGTGGTGGAGGGGCAAGAGGCGGCCCGCCTCGTCGGCGCGTGGATC
TCTAGTGCTTACCTGGACCGCCTCGTCGTGGAGGTAGTTGCAGTTACTGAGGACATTGGAACTGCTGGTGCATTACGAGCTATTTCAAAGAGACTGGTCG
CAAATGATGTTTTGGTGATTAGCGGCGACCTAGTAACTGATGTACTTCCTGGGGCTGTTGCTGCTACCCATAGAAGAAATGGTGCAGCTGTTACTGCTTT
ACTATGTTCCGTTCCTGTTAGTGGTCCTTCAGATGCTGCTTCTTCAGGAGGGAAAGATAAGGCTAAAAAACCATGTCGACTGAACATAGTTGGGCTAGAC
ATAACAAGACAATTCTTGTTGCATGTTGTATCAGGAACTGATGTTGAAAAGGATGTTCGAGTTTATAaga
page-top