Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11121  (registered. 2002)
Contig Information
Length 516 bp
Clones 5 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit endosperm transfer cell specific PR60 precursor [Triticum aestivum]
Score 555
Evalue 1.55852e-55
Total Hit Count 74
Registered year 2002
Contig Sequence     [ Download ]
>Contig11121
ttagacaatttgaggagaagGCTTTATTAgtttcagAAACGTTCTCATACAAAGTGCTTAACATAAACTTTCCTGAGCACAACCTCACGAATTACAG*AT
CTGAAAGG*AAAGCTATTGTGAGGCCAAGCACACATCGAATGTAAAAGCCAAGCTTCTCCTTCCACAGC*TAAACTAGAGTCACTACGCCAGGAATGTGT
AACTTCCGCACTTGTAGCCATGTGGGAACGGCTTCTTGCAGAAATTGGCAACGTATCCAACCTTCTCCATACAATATATCTTCTCTTTCTCCTTGGTGAC
ACCAGCGCAAAGGCATGGGATGTTTGCCTTTTGCCACACGGCGCAGCATGCGTCCGACGGATCTATCTTCGGATTTGCTGGCCACTTTTGATACTTCGCA
CACTCCTTGATCATGGCCTGTCGGTCACCCTCACATTCATCAGCCGAGACAGCTACCCCAATAGTGAGGATGatcaaacATAAGTCCATGAGTTTCgcca
tggctatggattttgc
page-top