Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10877  (registered. 2002)
Contig Information
Length 939 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative CGI-34 protein [Oryza sativa Japonica Group] >gi|20804449|dbj|BAB92146.1| P0455C04.24 [Oryza sativa Japonica Group] >gi|52076612|dbj|BAD45514.1| putative CGI-34 protein [Oryza sativa Japonica Group] >gi|125524063|gb|EAY72177.1| hypothetical protein OsI_00027 [Oryza sativa Indica Group] >gi|125568681|gb|EAZ10196.1| hypothetical protein OsJ_000021 [Oryza sativa (japonica cultivar-group)] >gi|215766133|dbj|BAG98361.1| unnamed protein product [Oryza sativa Japonica Group]
Score 994
Evalue 7.19797e-106
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig10877
ggacgcactcactctgctcaccaggtccctccactccagccgagaaaccgccgccgccgccgcccgcccgccggagccggagatgaagaagatcttcggc
gccaagaagagcaaggacccaccgcccaccatccaggacgccaccaaccaaataaacaagcggggcgagagcgtggacgagaagatcaagaagctggacg
aggagctggcgcggtacaaggagcagatccgcaaggcccgccccggcccctcgcaggaGGCCATCAAGGCCCGCGCCATCAGGCTCCTCAAGCACAAGCG
CATGTACGAGGAGCAGCGCAACATGCTCTACAACCAGACCTACAACCTCGACCAGGTCGGCTTCGCCGCCGACGGCCTCAAGGACGCGCAGCAGACCATG
GGTGCAATGAAGGCCGCCAACAAGGAGCTCAAGGGGATGATGAAGACCGTCAAGATCGAGGACATCGATAATATGCAAGATGAAATGACGGATCTGATGG
ACGTGAGCAACGAGATACAAGAATCTCTTGGTAGAAGCTACAACATCCCCGATGATGTTGACGAGGAAGATCTAATGGGAGAACTGGATGCTCTGGAAGC
TGATATGGAGTTTGAGTCAGCTGCAGTCCCATCATACCTTCAGCCAGATGAGGAATCTGATCTTAACTTGCCCGCTGCACCGACTTATCCTGCAGCAGTT
CCCGTAAGCAGGCACCAGGAGGACGAGCTTGGACTGCCACCGGTACCTCGAGCGTCGCTCCGTAGTTAGAACTTGGAAGTATTTCCCGACCTTGTTCTCA
GTGTTACTACCTCATTGTTAATGATGCGGGAGAAGTCTTTGTGTTTGCACTTAAACAATCCTTGTAAGCCATTTCTTGATGGTACTGCCTCTTATGGCTA
AGCTGTGCAATGTagctagtttccggctcaaaaaaaaaa
page-top