Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4790  (registered. 2012)
Contig Information
Length 743 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 4
Wh_r Root 1
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_MS Seed DPA5 of DT3DL CS wheat 5
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 8
Wh_SHC Shoot grown with cold treatment 6
Wh_VSCB Liquid cultured tissue 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 4
WH_SP 2
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|291410763|ref|XP_002721657.1|| PREDICTED: histone cluster 1, H2ag-like [Oryctolagus cuniculus]"
Score 208
Evalue 5.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4790
TTTTTTTTTTCAAGGATAAACTAGTTCGATTTCCATTCAATTCCATTCTACAGAAGATAGCAAACAACAGCGAGATACTGCGATTACATCAAAGACCACG
AACCCTAGACACTCTAATCTGGCGGCGGTGGTGGCCTAGCCTCCGAATCCGTAGAGGGTGCGTCCCTGGCGCTTGAGGGCGTAGACGACGTCCATGGCGG
TGACGGTCTTGCGGCGGGCGTGCTCGGTGTAGGTGACGGCGTCGCGGATGACGTTCTCGAGGAAGATCTTGAGCACGCCGCGGGTCTCTTCGTAGATGAG
CCCCGAGATGCGCTTCACGCCGCCCCGACGCGCCAGACGACGGATCGCCGGCTTGGTGATACCCTGGATGTTGTCGCGGAGGACCTTCCGGTGGCGCTTG
GCGCCGCCCTTGCCCAGACCCTTGCCTCCCTTGCCGCGCCCCGACATCCTTCTCGCTTCTCCTTTCTTCTCCTCGGTGAGGTTGACCTGTCTTTGTGAGG
TGTAGAGCTAGCAAATCTAACTCGCTCGTGATATTACAGTCCTTTCATCTAGTCTAGACTAGAAGAAACATGAGGGCGTACGTGAATGTGACGATCACCG
TCATCTTGCTCATCGGGTGCCTGGCGGTGATCGGCGAGTTGGGTCGTGTCGAGGCCGGGAGNAGCTACGGAGATGGGCGGCGGGCCGACGGCGGCGCGAG
NNNNNNATCGCTGAAGATCTGCGTGCATCGGTACTGCCACACC
page-top