Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4778  (registered. 2012)
Contig Information
Length 1103 bp
Clones alternative view 35 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 3
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115463787|ref|NP_001055493.1|| Os05g0402300 [Oryza sativa (japonica cultivar-group)]
Score 434
Evalue 7.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4778
TTTTTTTTTTAACCAAACGACGCGACAATTATTGGCATAAAACGTTCATACGATCACTGATTGTTGGCAGTTTAACAACACTCAACACTCAGGCACATAA
ACTCACAATAGAACGCCTATACATATGGTTGTACTTTGGCCTCATCTCTGGATGATGGCAAAAACTCACTACCATGTCTTCCGAGTTATGTAGATAGCAA
TTCAAAAGACTTGATAAATGTAGGACATATGCCTGGGTTGGCACAGGGTTCCTGGTGGTTCAGACAGGACCCATCAGTTGTCATTCTGCCTGAGCATCTG
TAGGATGGTCAGGAACAGGTTGAGAATGTCGAGGTAAAGCTCAACAGACGCCCAGATGTACTCGTCATAAGTGTGGCGCTTTATCAAGTTCTCGGTGTCG
TAGACGATGAAGCCTGAGAAGACTAGAGCTCCAAACCCGCCGATCACAGAATTCGATGCAGGTCCGAATGGGAAGAAGATCTGGGTAAAGCTTATCACGA
CCAGGATGGTGAGAGCAGAAAACAGAAATGGTCCAAGGTAACTAAATTCCTTGCCCTTCTTTGCGGCCCAGAATGTGTATGCAGTCAGAGAGACAACCAC
AGCTGAGGTCAGTACCAATGCTTGAAGCACAATAGTTCCTTCAGTGTTTGCACAAGCCACACCAATGCTGAAGCTCAAGCACAGAGTGAATAAACCCAAG
ATAGCGAGATTGTGAGGGTGTCGGTGCTGATAGATGTACAACGGGATCATCAGGATGAAGGGGAGGACAGCGAGCACGAGCGCGAGGACGGGCGAGTTGG
AGAGCGTGGCGTTGAGGGTGGGGTGGAAGACGGTGATGGCGGAGACGACGGTGGTGAGGACCAGCTGCGCGCAGAGGATGCCGTAGACCTTGCGGATGAA
GCCCCAGCGGAGGGCGTTCTCCCCGCGCGAGATCCCCGGGTAGAGCGTCTCCCCGTTCCCCGCCTCCAGGTCGATCGACGACGCCTCCACCTTCTCCTTC
ATCTCCGGGGCCCGGCGGTAGCCCGACGGTGCCAGCGGCTGCATCTCCGTCGCCGACGCCATCTCTCTCGCCGACGCTCTGGCGTGGGGAATTGGGGATT
TCG
page-top