Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4773  (registered. 2012)
Contig Information
Length 713 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218199833|gb|EEC82260.1|| hypothetical protein OsI_26455 [Oryza sativa Indica Group]
Score 358
Evalue 4.00E-97
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4773
GTCTCGTCTGCCCCTCCTCCCTCCGTGCTGCCGTCTTTGATTAGGTAGGTGAACTCGGTTATCATGGGCCTCGAGGTAGCAGGTGGCGGGGAAGCTGCAG
TTAAGGGGAAGTTCTGGGGTATAGTTGTCTGTTTTTTCTTGGGAAATGGAAGCCTATTTGCCTGGAACAGTATGCTTACCATCGAGGATTACTATGTCTC
TCTGTTCCCGAATTACCATCCGACAAGAGTTCTTACACTAGTATACCAGCCTTTTGCCTTTGGACTCACCTGCTTCTTTGCATACTATGAAGCAACGATG
AACACGAGGAAGAGAAATCTAGCTGGTTTTGCACTTTTCTTCCTTAGCTCTTTCGCGTTAATATTGCTGGACGTTGGTACTAAAGGACATGGTGGAATTC
CAGCATACATTGGTGTATGCATAATCAGTGCCTTTTTTGGGACATCTGATGCTCTTGTTCAAGGTGGCTTGGTTGGCGACCTTTCTTTGATGTGCCCGGA
GTTCATTCAGTCCTTCCTGTCAGGCTTGGCTGCATCAGGAGTTATAACATCAGCTTTGAGACTAATTACAAAGGCAGCTTTCGAGAACTCACAAAATGGT
CTTCGAAATGGAGCTATGCTATTCTTCTCGGTAACATGCATGTTCGAGCTAGCTTGCCTCCTCCTATATGCATTTGTCTTTCCCAAATTACCCATCGTGA
AGTACTACCGCCA
page-top