Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10446  (registered. 2002)
Contig Information
Length 1182 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit allyl alcohol dehydrogenase [Nicotiana tabacum]
Score 879
Evalue 1.77544e-116
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig10446
cacagcggcgatggcggagctaagagccggcgggtgatcctcaaggactacgtggagggctaccccacggaggagcacatggagctgcttcccgccgcgg
ccgtcgatgaggccgcggcggccgaggaggggtcggtgctggtcaagaacctgtacctctcctgcgacccctacatgcgccccaagatgtcccgcccgct
gcaccagtcctacaccgccgccttcgtcccgggcgccgccatcaccggctacggcgtttccgaggtggtccgctcctcgcggcccgggctcgccgccggc
gacctcgtctggggcatgaccggctgggaggaCTACAGCGTGGTGAAGCCGCCCTTCAcggccaTACTCACCAAGATCCAGCCCGACGACGGCGTGCCGC
TGTCCTACTACACGGGCATCCTGGGCATGCCGGGGCTCAcggcctACGTCGGCTTCCACCACATCTGCTCCCCCAAGGCCGGCGAGACGGTGTTCGTCTC
CGCGGCCTCCGGCGCCGTGGGCCAGCTCGTCGGCCAGTTCGCCAGGCTCCTCGGCTGCCACGTCGTCGGCAGCGCCGGGTCCAAGGAGAAGGTGGACCTG
CTCATCAACAAGTTCGGCTTTCACGACGCGTTCAACTACAAGGAGGAGGACGGCGACCTCGCCGGCGCGCTCAAGAAGCGCTTCCCCGACGGCATCGACG
TCTACTTCGAGAACGTCGGCGGCAAGATGCTCGAGGCCGTGCTGCTCAACATGAAGGTGCACGGCCGCATCGCCGTCTGCGGCCTCATCTCCCAGTACAA
CCTCACCGCCGGCGAGAAGGAGGCccgACGTCGGCGTGCGCAACCTCACGTCCCTCGTCTCCAAGCGCATCAAGATGCAAGGGTTCATCGAGCCCGACCA
CAAGCACCTCTACCCGGAGTACATGGCGTGGGTGCTCCCGCACATCAAGGAGGGCAGGGTCGTGTACGTGGAGGACGTCGCCGACGGGCTCGAGGCCGCG
CCCGGAGCGCTCATCGGCCTCTACCACGGCCGCAACGTCGGCAAGCAGGTCGTCAGGCTCACCAACCCCGACCCCCAGTGACTCACAGATTGTACTGTAC
TACTAGCAGATCAACCGCGCGTCAATCATCATCAag*aatAAAATCAAAatctattcgcatcgcaatcgcaatcgcatcttg
page-top