Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4755  (registered. 2012)
Contig Information
Length 844 bp
Clones alternative view 81 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_RDr Root of dessiccated seed 10
WH_XR Roots, 18 day old plants were grown hydroponically 10
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 28
WH_XT Roots, 18 day old plants were grown hydroponically 9
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 10
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|196051131|gb|ACG68733.1|| pathogenesis related protein 10 [Triticum aestivum]
Score 312
Evalue 3.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4755
TTTTTTTTTTTTTTTTTAAAGCAAACAAATATTTCCTTTTATTTCCGGGCAAAACCATGAGGAAGATACATAAGCAAGCAACAACATCATCAAACAACAG
CATGGCACCCTTTGATAGTTACAAATACTGAATACACGACCTTTTAACTTGTCAACTCCACACTCTGCTCAATGCTCCCGCGTCACTACTTGAGTTTGGA
GCGGCTTTATTAGATCGGGAAAAAAGCACACAAAAATCAAACCAGGGACAGCATAATCATAACCATAACCATGTATGTTCCCTCTCAACTGGTTCAGTTG
TAGGCGTCCGGGTTGGCGACGAGGTATGCCTCGGCGGCCTTGAAGATGGCCGTGACAGACTCCTTGGCCTTGGTGATCTCATCGTTCACCTCCACGCCCG
GCAGCAGCTTGTACGTCGACTCCACCTTGACGACGCTCCCGCCGTTGGCCGCCGCCTCCACCTTGATGTGCGAGGTGGCCGTCTCGATGGCGGTGCCGAT
GCCGCCGCCCTCGATGAGGGTGGACTTGCACTCGCACTTGTCGGCGTCGATGAACTCGAGCCTCTCCTTCATGAGGCTGAAGGGCATGGCTGAGGTGAAG
TTGAACTGCCTGACGCTGCCGATGCCGCCTTCGCCCTCGACGGGGTGGGCGCTGGCGACGATGTGCGGTGCGAGCTTAGGGGCCAGTGTGTGCCAGTCCA
TGACGCCGGCACGGAAGAGGCGCGACGCGGCGACCGGCGATTCGATCTCGTGGGTCCAACTGTCGGTGAAGGCCATTGCTGTGATGATCAAGGACTCGAC
CGGTGCAAGTGATGTGTTGAGCTGTGGCTGTTGTAATGGCGCAC
page-top