Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4749  (registered. 2012)
Contig Information
Length 1088 bp
Clones alternative view 17 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 3
Wh_yd Spikelet at late flowering 1
Wh_PCDAM Anther at meiosis 2
Wh_RDr Root of dessiccated seed 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|17887465|gb|AAL40895.1|| phosphoethanolamine methyltransferase [Triticum aestivum]
Score 594
Evalue 7.00E-168
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4749
GCCGCTGCCAGTGTCACTCGCCGCCGGCCACCGTAGGATCGAGAGAGAGGGCAGCATGAGCGAGCAGGGGGCAGGGCAGGGTACCAAGGAGCAGTCAGTG
CCGGCCACCGTAGGGTCGAGAGAGATCAGCTTGAGCGGGCAGGGGGCAGGGCAGGGTAGCAAGGAGGAGAGACTGGCCGAGCTGGAAGAGCTCGAGCTCC
AAACGGACCACCAAGGGGTGCTGGCCATCCTCCCGTCGTACGCGGGCAAGACGGTGCTGGAGCTCGGCGCCGGCATCGGCCGCTTCACCGGCGAGCTGGC
CAAGGAGGCCGGCCACGTCATCGCGCTCGACTTCATCGACAGCGTCATCAAGAAGAACGAGGAGATCAATGGGGACATCTACAAGAACATCACCTTCATG
TGCGCCGACGTCACCTCGCCGGAGCTCAAGATCGAGGACAACTCCGTCGACATCGTCTTCTCCAACTGGCTGCTCATGTACCTCAACGACGAGGAGGTTG
AGAAGCTGATTGGCAGGATAGTGAAGTGGCTGAAGCCCGGTGGGCATATTTTCATCAGGGAATCGTGCTTCCACCAGTCTGGGGATTCCAAGAGGAAAGT
GAACCCGACGCACTACCGGGAGCCGAGGTTCTACACCAAGGTGTTTAAGGAATGCCACTCCTATGACCAAGAGGGGAATTCCTTTGAGCTTTCTCTGGTA
ACTTCCAAGTGCATTGGAGCTTATGTGAAAAGCAAGAAGAACCAGAACCAGATATGTTGGCTGTGGGAGAAGGTCAAGTGCACAGAAGACAAAGGCTTTC
AGAGATTCCTGGACAATGTGCAGTACAAATCCACTGGAATCTTGCGTTATGAGCGCGTGTTTGGGGAGGGTTATGTTAGCACCGGTGGATTCGAGACCAC
AAAGGAGTTTGTGGACAAGCTGGACCTGAAAGCTGGCCAGAAGGTGCTCGATGTAGGGTGTGGTATCGGAGGAGGCGACTTCTACATGGCTGAAACCTAT
GATGTCCATGTCCTCGGCATCGATCTTTCTATCAACATGGTTTCGTTCGCAATTGAGCGTGCCATCGGGCGCTCGTGCTCCGTTGAGT
page-top