Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4748  (registered. 2012)
Contig Information
Length 674 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115455631|ref|NP_001051416.1|| Os03g0773300 [Oryza sativa (japonica cultivar-group)]
Score 209
Evalue 3.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4748
CAGATTTTATTCTCAGTATAAGTTACAGAAAACTGTCTCACTGAAAGGGGTGGGAGATAAAGAAAGCCTACTCCTTGTATACACAGTTTTTTCACCTACT
AGGACAGCAAAATATGCACATCAGATGATGGATTATACGCATCTGAGATTAACAACAGCAAAATAGTCTCAGCTCATGTAACGTATAGCTAATCTATGGT
GATCCTACACAACAGCTCTGTCTTCCAGCTCTACTGGATCCGGGAGCATCTCCCGTGAAGCCTTCTTGAAGGAGAAGGAATTTTCCTCCTCGTCGCTTCC
TTCGGATTTTGCTGACTGCCTACAGGTAAGTACTTTCCCTGATGTTTGCACCTCGGAGTACCGGTACGAGTGCCCATGGAAAGCAGAACGCCAAGAGCTT
CGGGATGAGGTACTTGTGAGCCGAGCGGAACTGGGGCTCGAGAATAGCTCTTCCCGCACCACCCCTAGCGGGTTCTCCAGCGCTTTCAAGATGTACCGAG
CGAGAGGCCGCCTGGAGGGCTTTGGATTCAGGCATGTCTTCGCGACAATGGAGACTGCCCATACTTCTTGTAGGTGGTCTTCGTCCACAACAAGTGNNNN
NTCTACAATATTTGTGACACTCTCCTTGTCATGGGTTTCAATGTAATCTAAAGTGCTTGACAACCACTCCTCTG
page-top