Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4746  (registered. 2012)
Contig Information
Length 696 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226508938|ref|NP_001142581.1|| hypothetical protein LOC100274845 [Zea mays]
Score 140
Evalue 2.00E-31
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4746
AGATACACATACACATGCAGCTCTCTTCTAGGAGAGGCATCGCCAAGCATGCAGCTACCGCGCGCTATTGGCCTTTTATTCTCACGCCTTTGTCGTCGTA
GCTACAGCTAGCTAGACGTATACGCGGGCGTGTACGTACGCACGAGCCATAGTCGGTCGAGGTAGGTCTCCGTATAGAGCTACTACTCGCCGGTGACACG
TACGCACTATAACTTACATATAGGAGTACACTCTTAATAGTTATGGAGTACAGTATTATAGATGCGACACCGCGGACGTCACACCACCTCCTCGATGATG
GCTCCGGCCACCGCTTCCCAGCCGCGGAGGTGCTCGTCCACGCTGCTGCTGCCACTCACATGGAGGTTGAGGCCGAAGCTCATGCACTGTTGCACGCATA
ATTCCTTTCTTGTTGGGTCTTGCCAGTGTTGACATTTCAACTCGCAGTCTTCTCTGCTAGGATGATGATGCTGCTGGCTGTGGCACTGGTCCACACAGAA
CTGTCTCCTGGCCAGATCTTGGTAATAGGCGCACTTGATGTCGCAATCGTCGTTGCCATGGTCATCGGCACGCGAGCCGACCTCCTCCTCCACGTGCAAG
GTGGTAATGGTTGTGGCCCCATCCTCCTGCTCGGCGCCTACCGTCGCCGGAGCCAGCAACACCATTGCGAGCAGGAGGAACCACCAAACCCCACCC
page-top