Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4745  (registered. 2012)
Contig Information
Length 761 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_RDr Root of dessiccated seed 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|138753444|emb|CAM57979.2|| NAC transcription factor [Hordeum vulgare subsp. vulgare]
Score 342
Evalue 3.00E-92
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4745
CCAAAAAAAAATCATTCCAGGGTTTTAGTCCTCCAAAATCGACTGGAGAAAAAGAAAATCACCGCGTCCTCTACTAAATACTCACACTCAAGAAACATTG
CACCAAACAGACATAATTATACATTTTGATATGAAATCATCACACACACACACACACACTGCAGATTAACTACTAGCTAGCCAGTTGTCTGCTTATGTTT
TCTGGATAAATAAGCAAATTCGCCTAGAAGTGGTTCCAAGTAGAGCTCACTACAGCAGCCATCTGAGGAGACATGCTCGGCACCACCTCACCACCCATGG
AGCTCAGCTGGCTCAGCACTGCCTTAAGGACCTTCTTGTCACAGTTCATGGCGGGGTCTAGGTAGCTCCCAAAGTCAGGCAGGCCATGGTCCAGGTAGCT
CATGCCATTACTGTTGCCTGTCACCATGGGGAGGTAGCTGCTGTTGCTGGCACTGTTATTACTGAAGCTGGAGAAGCAGGGCACTTGCTCAAGTGCTGCG
GCGGCGGCGGCGGCTGAGGAGGTGTTCATGGTGGCCTGGAGCTGTGCTAGGGTGGTGTCCATGAGAGGTGGCAGTGGCGGTGAGGAGGTGTCTGTGGATG
TGCCATGGACAATGTTGGTGAGGTTCCTTGGCCTGGGGGTGGCACCAACTCCTGATTTCTTCTTGCAGATGACTCTGCACAGGACCCAGTCCTCCTTGGA
AGCTTGCTCATGTGCACCCTCCAACCTGTATTCATGCATCACCCACTCAGTCTTCCTCCCT
page-top