Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10250  (registered. 2002)
Contig Information
Length 564 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_r Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit peroxidase [Triticum aestivum]
Score 661
Evalue 1.02973e-67
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig10250
gatTAGTGCCTGCTTGCATACGG*AAGTACACTGATGGCAATGGCAATGGCCTCTTCTCTGTCGGTGCTGTTGCTCCTGTGCCTGGCGGCATCGTCCTCG
GCGCAGCTTTCGCCTAGGTTCTACGCGACGTCGTGCCCCAGGGCGCTGGCCATCATCAGGAGGGGTGTGGCGGCCGCCGTGAGGAGTGAGCGCCGCATGG
GAGCGTCGCTGCTCCGGCTGCATTTCCACGACTGCTTTGTCCAAGGCTGCGACGCGTCCGTACTGCTGAGCGACACCGCCAGCTTCACCGGCGAGCAGGG
GGCAGCTCCGAACGCCGGCTCAATTCGTGGCATGAACGTCATCGACAACATCAAGGCGCAGGTCGAGGCCGTGTGCACGCAGACTGTCTCGTGCGCCGAC
ATCCTCGCCGTGGCCGCCCGCGACTCCGTCGTCACCTTGGGAGGGCCTTCGTGGACCGTTCCTCTGGGAAGGAGGGACTCGACGACGGCGAGCTTGTCTC
TGGCCAACAGCGACCTTCcgccgccatccttcgacgtggccaacctcacggccaacttcgccgc
page-top