Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4732  (registered. 2012)
Contig Information
Length 682 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_SH - 1
Wh_RDr Root of dessiccated seed 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|150246969|emb|CAN84874.1|| putative mixed beta glucan synthase [Triticum aestivum]
Score 165
Evalue 4.00E-39
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4732
AAAGACATCAGTGGCGACAGGGAGGTGAACACATGCACGAATTAATGAAATTAAATTTATTGTTTNCATATAATACTACTAAAAGAATACCGCCCTCCAC
CCCACGGGCCCAGCACTCCCAGCCTCTCTCATCTCTATACATCGTCGAGCATGTACATCCCGTACCCGCTAAGTCGTCTCCCTTGTTCTTGGCGTAATGT
ATAATTAAGTACATAATTAATTACCACAGGTAATTAAGAACTAAATCAAATCAACACCATCTTTTTTCTGGACAAAACTAAAAAGAAACGGGCAAAAAAG
TGAAGAAAAAAATTAAAAAATGCAAACTTTGGCGGGCTCTGCTTGTCGATCAGATTGATGCATGCACTGTTGAGTGGATGACTTGTTGTTTCATGTCTCA
GGTCATCTTGTCCGGATGCGCGGCGGCAAAGTCGTGGACAGTGGACAGGGACCTCACGGCCAGTTGTAGTACCCTGCGTCGACGAACTTCTTGCCATGGT
GACCATGCACCGTTGTGTGCTTGCCTCCCGAGCTATGCATGTGGGGGATGTTGATGTAGAGCACGGCGGTGATGACGANNNTGAATGCCCACCAGACGAG
CACCACGACTGGCGTCTTGCCGTGCTTCCCCAGGATGCCCTTGGCGAACGGGTAGAGGTGGAACAGCACCCAGAAGTTGAAG
page-top