Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig4728  (registered. 2012)
Contig Information
Length 979 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_VWD Shoot grown with dessication 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222637603|gb|EEE67735.1|| hypothetical protein OsJ_25425 [Oryza sativa Japonica Group]
Score 527
Evalue 7.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig4728
AAGAACCGACTGTGAATGCAACTGATGAGCTGAGCAAAGCATTGGCTGATACACTTAATATTGANNNNNGTACTGATAATATGGATGCCCAATTTCTTGC
TGATAACGGTGATGATTTTTTCAATAATCCTCAACCTTCAGAGACTAGCTTGGCTGAGGAGCCAATGTCTACAAATGTCCAAGAGATTGAGCAGGAAATG
CCTGAAAATATTGTGCCATCTGATCCATCAATTGACAAAAGTATTCAACATGCATTGGTAGTTGGAGACTACAAAGGTGCTGTTAATCAGTGCCTTGCAG
CAAATCGTATGGCTGATGCTCTGGTTATTGCCCATGCTGGTGGTTCTGCTCTATGGGAGAGCACCAGAAACCAATATCTTAAGAACAGTATCTCACCCTA
TTTAAAGGTTGTTTCTGCTATGGTTGGCAATGACTTGATGAGTTTTGTGAGTACATGGCCACTAAATGCATGGAAGGAAACACTTGCACTACTGTGCACA
TTTGCCGGGAAAGAGGAATGGAATGTTTTATGTGACACTCTTGCATCTAGACTTCTGAGTGCTGGTGATATGCTAGCTGCGACCCTATGTTACATTTGTG
CTGGAAATATTGATAAAGCTGTTGAAATATGGTCTCGCAACCTGAGCTCTGAAGATGGTGGAAAGACTTATGTTGATCTTCTCCAGGATTTGATGGAGAA
GACCATTACTCTCGCCCTTGCCACGGGCCATAAGAGGTTTAGCGCGTCTCTATCTAAGCTTGTTGAGAACTATGCAGAGCTGTTGGCCAGTCAAGGCCTT
CTTAAAACTGCAATGGAGTACTTGAAGCTTATGGGAGCAGATGAAAATTCAGATGAGCTGACTATACTGAGAGATCGAATTGCATTTTCTACAGAAGAGA
ATGATGCTACCAGGAGTTCTGTTCCAGAGAGTAGTGCCAACAGCTCCTCCTACCTACCAAATCAACAGAGCTACACCCC
page-top