Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig10004  (registered. 2002)
Contig Information
Length 766 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit SEC14 cytosolic factor (secretion factor 14) family protein [Brachypodium sylvaticum]
Score 397
Evalue 8.24498e-37
Total Hit Count 116
Registered year 2002
Contig Sequence     [ Download ]
>Contig10004
atcagatgagaggtggcagtgcccctaccatttacacagacatcatcagctcagcggtaaagcctgtcactcgctgttctttcgggtcagtcaaacctcg
acggattccattcccgctcccgcccccgCCCCCAGTGGAACGCAAAGGCAGCCGcagcagagattcatACActtttggcCAAcaAAAAACATAGCACGTT
GCGCTGCACTGCGTTCACCaggggaAGGTGAGCGAG*G*GGGAGGG***GGCTACCGGGCTCAAAATATGAACTAATAATAACCA*AAAAATAAAAGGAG
AGCCGATGTTCCGAAAGGAAGCGACGAGCGTCTCGTCGTATGCTATCTTCTCTTTCGCCGTTCTCTCGAGCCGGACGGGGGGAGGTCAAAAATGGCGCTG
GCAGCTTCACTGTTAATGTAGTCGACATGGTCGGTGCCTCGGACCAGATCAGG*TCAGGTCGTCCTATGAGCAGAAcagcctCCTCTTGACTCTCGACGA
CTCCTGTACAGCTTCCAGAGTCTCCGCcaacgaATTCTGctttgcCACCGTCGCATGCAGTGCTCTTTTGGTCCTCTCCAGGTCGGCCTCGATGGATCTG
ATGCGCTCGAACGAgttcagtaacTGTTGCTCCTTGTCctcaggcATCTCTGGTGGCTTGCTTGCAAGATGGTTGCACACAgactcaagattttcaatgc
gctgtaagcaagcactcatctcatcagcaccgatggttcggggctgcggcttctctgcagctggga
page-top