Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9905  (registered. 2002)
Contig Information
Length 720 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays] >gi|195648368|gb|ACG43652.1| hypothetical protein [Zea mays]
Score 291
Evalue 1.4584e-24
Total Hit Count 16
Registered year 2002
Contig Sequence     [ Download ]
>Contig9905
ttcggcacgaggcctcgccgcccgccggcgatctcCGTATACGag*agGAAACAAATAGCCAGCCGGCAACTCTCCCGCACTCCGGCTCGGTAGCCTTTC
CCTTTCCCCGTTCGGTTGGTCCAAGCGCTCGCGCTCCTGGCTAGCTGGTTGGCTGGATCTAGCCGGCCAGAACCCTAACCTAACCCGGCGGGTCTCCAAT
CCTGTCCGCATGGAGCCGGCCGCCAACGGCGACAAGCCCTCCGACGAGCAGCAGCAGTTCGATCCCAGCCGGATGATTGGCGTCATCAAAAGGAAGGCCT
TGATTAAAGACCTAGCCGCTGCTTACCACGCTGAGTGTGTAGCATGTTGTAAAGAGCTTCTGGAACTCCAGAGGAAGTGGGAGGAGGAGCAATGTGTCGA
AGCTAAGATGCCCGAAGTGCCAAAACCATCTTCGACGAAGCCTTCTAAGCGCAGGAAGAGGTAGATCTACCAGGGGATTAATCGATGCTGCAGTTTACTT
CAGTGGGGGAAATGGGAAGAGAAAAGAAAAGACTCATGTAAACATAGTTGACCTCCTGATACACAGGAAGGCGTGGTGAAAAACTCTACTGAGATTCGTG
GTCTTCAAAATGTGGCACGAGCTAGTAAAAAAGTTTCGAGTAATGTGTGTGTACTGGTGTGGTCAATCACCATGTGAACTTGTGAAGTGAAGCAACCTAC
TATCacgggcTTGCTGCTgt
page-top