Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9881  (registered. 2002)
Contig Information
Length 805 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195627532|gb|ACG35596.1| TPR domain containing protein [Zea mays]
Score 582
Evalue 5.02095e-68
Total Hit Count 31
Registered year 2002
Contig Sequence     [ Download ]
>Contig9881
gggctgaggaattcggcacgaggaatataaaaaaatAAGacgagAGAGCCACCCCCATCGCCTCGTCTCTCCTCTCCTCGCAGATCTTTCCCGTCTCcgg
ccaCCATGAACTCCTACTCCGGCGACCGGTCCTCCTCCCGTCCCACCACAACCTCCTTCGACTCCTACCAGTTTGACTTCGGGGCCAACGCCTCCCGCTC
CTCCACCTCCCGCCCCCTCCGCGACCAGAGGCCAGGTGGCGCCACCAACCCTTCACCGAGGCCAACCACCACAAACACATGGTCACACCAGCCGGTGAAG
ACGTCCTGGACTCATCAGCCATCCCCGTCCGCCGCCGCGGCGCTCGGATCCGGGCCTGTGTCCATGGTCGGCGACATCTCCGGCCGGAGCTGGTCCGCCA
CTGCGCCCTCCTCCGGCATCGGCCTCCCTCAGTCCAACAACCCCAACCTCTTCAGCGACCTCCTCGGGCCCGCGCTTGGATCCACCCGAGCCCAGTCCAA
CGCGCCGCTCAGATCAGCAGCGGCCCAGCCCTCCAAGCCGTCAAGCGCTAACCCTAGGACCAACAGCTCTTCCTTCTCGATGGGCGGTATGGCGAGCACG
CTCCCGAAAACCACCGGGGCACCGATAGCTTCTGGTAGTTATGGGGTTGGTGGCCGGCCAATGAAGCCGGTGGGCATGGCGCCGGCGACCGCGTCACAGC
CCACGGCGCAGAAGAagggatccgttcggctccatagatcccttcgcggcgaagcctgggtctatgaatgctgcaaagcaggcaggttcggccaaatcgg
atcag
page-top