Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9880  (registered. 2002)
Contig Information
Length 791 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit serine/threonine-protein kinase 38 [Zea mays]
Score 259
Evalue 8.97358e-21
Total Hit Count 22
Registered year 2002
Contig Sequence     [ Download ]
>Contig9880
gggatatacatacaaaaactttgatgctgtgaaaggattaaaacatgcagatatgcaaaggagctcatcgctaacaaggccctctattggtgctatattc
ggatcaaatgGCATGGAGTCATCGAGAGAACCAAATGGAAAGGACACACACATGCACACCTTTTCTTCCGGGGATCCGATGAGTCCATAACCCGGCGTGG
TTCTGTTTGTTGCTGAGATTTTTCTAAACTAAATTAGCATGCAAACGACTGAATGAAGTGGCTTCGTCTGGACAACCTGCTTGTTTTTAGCCAGGTTTCT
GCCCTATTAAATCGTTGGCGAGCAGTTTGTAGAAATCCAAGAAAGCTTCTAGCTGTAAAATAGTATGCTAAGGACTAGACAAATGGTCCATCCACCGGTG
GGCTCGTCGTGTTTGGTGTAGCGTGTTCCGACCAAGTGGAGATGGGCATGTTTGGGAGGGCTGGCTGCCCAGGTTGGCAGAGCAAATTGCTGCCTTCTCT
TGTGGCAGTTCCTGGTCCGCTAACATTTGATCATGGAAGCGAAATAAGGTGGTAACTGAGGCAGGCTAAGCTATTGTTGTTGGTGGTGTTTGATACATAT
GTACCAGAAGATTTCCATTCAGAGACATGGCCCTTGGTCAATGGT*CT*CCCGTTGCAGAAATGCCTAAATTTTTGTTTACTGTattgttcgccagttat
atttgaacattgaacatttttggtggaagtgtcccttattttctttccgcaacatccatatgcaagaactgaattctgtgagagtgattat
page-top