Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9878  (registered. 2002)
Contig Information
Length 1161 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit expressed protein [Oryza sativa (japonica cultivar-group)]
Score 768
Evalue 1.60209e-79
Total Hit Count 75
Registered year 2002
Contig Sequence     [ Download ]
>Contig9878
attcggcacgagggaacagtagctgatggacttaggggagcttttgcaaagtctggtgaagtcgtgcatggttctcttttgacaaaccttccagcatcat
ctgtaaaaaaatcaaggtggtatatgatcaatgcaaaccgttcaGGTCCTTTGACAGTGCGTAAAGAATACCGCAAAGTACTTCCTTCTTTCATAAGGCC
ATCTGCATCTTACTCCACACAAGCTTCAGAAAAAAGACCAAAACAGGAGAGAACAGACTTGACGACTGTTGAAGATCCCTTTAATGCGCCTACCTACAAT
ATACCTGAGAAGCCAGTGACATTTGTCGAGGGCGCCTCTTACAGTGTTGTAATACTTGCTGGGCTTGGAGTTGCTGCATTGGCTGGATACGCTGTTTTCA
AAGAGCTTATATTTGAACCAAAAGAGTACAAGATTTTTGGGAAAGCTCTAGCAAGAGTTCAGAGTGATAGCCAGGTTACAGCCAAAATTGGTTACCCTAT
AACTGGTTATGGTACGGAATCCAGAAACCGTGCAGCTCGGCAGCGCATCCAAAACAGGGTTTGGACAGATGAGGATGGTGTTGAACATGTGGAGGTAGGC
TTTCATATCCGAGGGCCGCATGGAGCTGGAAAGGTGTTTGCGGAGATGTTCAAAGACAGCTCCGACAGGACATGGAAGTTCACGTTTCTTCTCGTCGAGA
TTACGTCACCGCGACCCGCACAAATCATGTTAGAATCTTACCTACCAGCATAGGGATGCAAGAGACAACATCAGCCAGCAGCGGCACATCTATGCGACAC
TTCATTTTACATCCTATCTCCAATGGCCTGCATCTGATGTTAAATACCCGTCCTCGGATTAAAGAAGTTGTGAATTTTGAACTTTCCCGAAAGCATAAGT
AGGAGGAAGATGAACCATCAGAGCTGCTGACCATCTCTAGTATCTTAGACATGGTGTACCGTGCAAGGACCTTGATGTTGTTGCTTTGTTTAGCTGAAAG
GCGCGCAGGCACATGTATACAAgccatctttcctgatgctcctcaaacaacatggaacggagcgagtgatccttcatctatcgagttgtggtctcgtttc
aggcagttttaatgatgcctaggatttcatgcaaacctccaatatgtccaaatagcaataa
page-top