Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9877  (registered. 2002)
Contig Information
Length 379 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_h Spike at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit probable sugar kinase protein [Rhizobium etli IE4771]
Score 77
Evalue 3.55887
Total Hit Count 9
Registered year 2002
Contig Sequence     [ Download ]
>Contig9877
gcctCACACTCTCtgatcag*agTAGCACTAGCTTCAGCTAGCCAGCCTCTGCCACTCCGGTCATTTTCTTGCATCCACGACGGCAATGGCCACCGCTGA
TGTCCAGAACCCATCGGCCGCGCTGACGGAGGAGGCGCCCGCGGTGGAGAAGCCGGTCGCCGCCGAGGAGGTCGCGTGACGTGGGCTAAATAAAAGTGTT
GTCGGGGCCAGTCGACGCCCAGTGTCGGGTCAGCAGCGAGCGAGCGAGCGACGCAGCGCCACTCGCCGGCACCCGTGTGCCTGCGTCTGCTCAGCTGGAG
CTTTGTTGCGGTGTGTGTCACAGTGTCAGTTCCACCTATGATCG*ATCGGTATCCTATCCGGTTTGTGtaaaaaaaaaa
page-top