Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9875  (registered. 2002)
Contig Information
Length 642 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195617588|gb|ACG30624.1| ATP-dependent Clp protease adaptor protein ClpS containing protein [Zea mays]
Score 566
Evalue 1.48154e-56
Total Hit Count 343
Registered year 2002
Contig Sequence     [ Download ]
>Contig9875
ccgctggcccgccgccctccCGGCAGGAAATACATGTTCTTTCTACAGACAAACGTTGCCACCCCCATTGTAATCACAGCAGCTGCACCAGGCAAAGGTG
GTGGTGTGCTTGATCGac*cagcAGAGAAAGTTTCTCCTGGCCGTCAATCTGAATTCGATAAGAAGAAATCCCGGAAGATGTCACCTCCATTCCGAGTCG
TCCTGCACAATGACAATGAAAACAGGCGGGAGTATGTTGTCCAAGTCCTGATGAAGGTTATCCCTGGGATGACCGTCGACAATGCTGTTAATATCATGCA
AGAGGCACACGTGAATGGGATGGCAGTAGTTATTGTCTGCTCGCAGCCGGAAGCGGAGGAGCACTGCACGGCACTGAGGGGCAATGGCCTCCGAAGCTCA
ATTGAACCTGCAAGTGGTGGC*TGCTGAAAAAATGGTTTCCTTTTTTGCCACTTAGTTTGTAGGTACCCCTGCATATCCAGATACAGGCGCTCGTTGTTA
AAGATGGACATGGTTACCTCCATGCTTCTAAATCGAGGCCGCTGCAacccgaTATATCAGTTTGGGGGTCTACCGTCTACCGACATGGCTATAACCTATc
atttttgTAAATATCATTTTTGCACATATCATCTCATATAga
page-top