Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9858  (registered. 2002)
Contig Information
Length 945 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_018964 [Oryza sativa (japonica cultivar-group)]
Score 1003
Evalue 6.51573e-107
Total Hit Count 385
Registered year 2002
Contig Sequence     [ Download ]
>Contig9858
tgcacaagaaagatgttatgaaggccagtgttatgcttgagaggaagaaggaatatgcaactATCTTGGCGTTTGATGTCAAAGTGATGCCTGATGCCCG
TGATCTTGCAGAAGAGTCTGGCGTGAAGATCTTTGTGGCAGATATAATATACCACCTTTTTGACCAATTCACAGCATACATTAAGAACATAAGGGAAGAG
AAGAAGAAGGACAGCGCCGAAGAAGCTGTTTTCCCTTGTGTTCTTAAGATCATGCCGAACTGTGTCTTCAACAAGAAGGATCCAATTGTTTTGGGTGTCG
ATATCCTTGAAGGAATAGCCAAGGTGGGAACGCCTCTGTGCATACCCTCGAAAGAATTTATCGATATTGGGAAGATTGCCTCCATTGAAATTAATCACAA
GCAAGTTGATACAGCCACAAAAGGGCAAAAGGTGGCAATAAAGATCATTGGGAGCAACTCTGATGAGCAGCAGAAGAGCTTTGGCAGGCACTTTGAGATG
GAAGACGAGCTTGTGAGCCACATAACAAGGCGGTCCATCGACCTTCTTAAGGAGAACTACAGGGATGACTTGACGATGGACGACTGGAAACTTGTGATGA
AGCTGAAGAAGATACTGAGCATTCCATGAGTCTGTTGACAAAGGCAAGCCCGGCGTGACCCCGTCAGCGAAGAGCCCCCCGAGGCCACCTCACCTCGTGG
TCGCGGGTCGGCATGACAGAGAGAGTGCGTGCATAAATTGACGAGGGCGGTAATTCCTTTTGTTGCGCCATTCAGACACAAACACGGTGTTTCAGTTTTG
ATGATGATGATGATACGGTCGGTCGGTCGGAGAGATGATGCGCCTAACTTTATTACAAGTAATAACAGCAGatttacctacttttgggagggagtggcgc
ttttgtttggttttgattgatggcgttttgttgcactgtgttaac
page-top