Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9840  (registered. 2002)
Contig Information
Length 961 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cytochrome c oxidase subunit [Triticum aestivum]
Score 521
Evalue 5.21221e-51
Total Hit Count 229
Registered year 2002
Contig Sequence     [ Download ]
>Contig9840
atgcctTGTGAattaagAAGCAGGTCATTGCCTCCTTTATGCAGATTATATGTGCTATAAGCTATATAaccaaatAAAATGTACTACTTAGAAGACAGGA
GAAATGAAATGGGTTTCAGAAACATCGGCCCTGCTAGAACTAGGTTGCTAATTTTATTCCATGCGGTTTAGAAATTTCCTGTGCAACCAAAATGACCGCC
TTGAACCGTGCCACGCAAAACAGCAAGTTCAGTCAAATTCCAAAGGTGGATGTTGTATAAAATCCAGTGAATGATCGTTGGGAGAAACTGATGGGCAGCA
CCTTCAGCTTACATCAAGTCAAAAACTTATTTGTAAGTAGTCCTCAAAAAGGAAAGGAAGGTGACGAATTCTCGGCACAAAGTAACTTTGTCCAGTCACC
AGGGAGGTGGGGATGATGGCATGTTTGTCCTTCCAGCGCCACTGAAGCTTACAGGGGTCCAGGGAACGTACCATTCTCCCGTTGCTCGTTCCAACGTTCA
ACCCATTCACTTGGGCATAGTGATCGGTAGTACTTTGCAAACTTTTCACACTCAGGAGCATCATCTCCTTTTGCAGCTACGCACCTATGGTATTCAACAT
AGCGTGTGAAGCAATGTCTTGTTTGATTTGTTGTGGGGAAACGAAAATCTGCTGGAGCCGTCTCAATCACAATTTCTGGTTTCTCTTCAGTTTCCTCAGG
AGCCGCATCGCTTTCCTCTGCAGCAGG*AACAGTTTCTTCCGCTTCTGGCTCTTTCACCTCAGGAGTTtcactTTTTTCCTCAACATCAGCAGCAGGCTC
ATCAGCTGGTGAGGCCTCAGTGATCGTAGCAGATTTCTCCTCAGCTGGTTTTTCCACAGGGACCTCCTTGGGTGGGAGTGAATATTCCTCGGCCAGCGTC
GGGACCTTGCCTTCCGCCGCCATGGTCGCGCCGCGGGAGatctggagtcacgcgcggcggc
page-top