Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9689  (registered. 2002)
Contig Information
Length 616 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_11609 [Oryza sativa Indica Group]
Score 793
Evalue 6.38401e-83
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig9689
acCCCCatgcccctATCTATCCGAGGGAAGGGAAGgtcaaacCAGCCGGCCCGCCCCCCTCTTCTCCTGCCGCCCGCTCCGATCGCCGCCCCCCTCCACC
GCCTTCCCTCCCGAGGATTCTGCATCTATAGGTTTGGTCATGGCGTCAGCTGCCTATCTTGATGACATTGATGCTGAAGTTATCGACCCTCCAAAGATTG
AGATGTTAGATGTCACAGAACTCGTCGGTGATCTTATCGAGCACTCACCGAAACCAAATGTCATAGTTTCTAGCAATGTGCGTGAGCTATTGGAATGCCC
TGTGTGTTTGGTCGCCATGTATCCTCCAATTCATCAGTGCTCCAATGGCCATACCATTTGTTCTGGATGCAAGCCAAGGGTTCATAATCGATGCCCAACT
TGCAGGAGTGAATTGGGTAACATAAGATGCCTTGCTCTGGAGAAGGTTGCTGCCTCTCTAGAGGTTCCATGCAAGTTCCAGAACTTTGGATGCGTGGGAA
TATATCCTTATTACTGCAAGCTGAAACATGAATCACAGTGCCAATACAGACCCTATACTTGCCCATATGCGGGATCTGAGTGCACTGTCACcggtGACAT
tccataTCTAgtaaat
page-top