Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9324  (registered. 2002)
Contig Information
Length 588 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H3.2 >gi|55977043|sp|P68428|H32_WHEAT RecName: Full=Histone H3.2 >gi|55977044|sp|P68429|H32_MEDSA RecName: Full=Histone H3.2; AltName: Full=Histone H3.1; AltName: Full=Major histone H3 >gi|55977045|sp|P68430|H32_ONOVI RecName: Full=Histone H3.2 >gi|19607|emb|CAA31964.1| unnamed protein product [Medicago sativa] >gi|19609|emb|CAA31965.1| unnamed protein product [Medicago sativa] >gi|21797|emb|CAA25451.1| unnamed protein product [Triticum aestivum] >gi|488565|gb|AAB49545.1| histone H3.1 >gi|2565419|gb|AAB81995.1| histone H3 [Onobrychis viciifolia] >gi|195605922|gb|ACG24791.1| histone H3 [Zea mays] >gi|195611126|gb|ACG27393.1| histone H3 [Zea mays] >gi|195622802|gb|ACG33231.1| histone H3 [Zea mays] >gi|217075590|gb|ACJ86155.1| unknown [Medicago truncatula]
Score 673
Evalue 4.57754e-69
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig9324
ttttttttttagcagaaaatatgcgtgatcccatttaTCAAACCAGAGATTTGAACATTTGATGGCATCCATTAGAAATACAAGGAGGGAAACATAAGGA
GGAGCAGACAACTACAGAGTCATAAACATCTAGCGGGATTCAAGGGCAGCTGACACAGGGCGGATACAGAGCCTAGGCGCGCTCCCCGCGGATGCGGCGG
GCGAGCTGGATGTCCTTGGGCATGATGGTGACGCGCTTGGCGTGGATGGCGCACAGGTTGGTGTCCTCGAACAGCCCCACCAGGTACGCCTCGGCGGCCT
CCTGGAGCGCGGAGACGGCGGAGGACTGGAAGCGGAGGTCGGTCTTGAAGTCCTGGGCGATCTCCCGGACGAGGCGCTGGAAGGGGAGCTTGCGGATGAG
CAGCT*CCGTGCTCTTCTGGTACTTGCGGATCTCACGGAGCGCGACGGTTCCCGGGCGGAAGCGGTGGGGCTTCTTGACGCCGCCGGTGGCCGGCGCCGA
CTTGCGCGCCGCCTTGGTGGCGAGCTGCTTCCTGGGCGCCTTGCCGCCGGTGGACTTGCGGGCAgt*ctg*ctTGGTGCGGGCcatcc
page-top