Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9302  (registered. 2002)
Contig Information
Length 759 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0237200 [Oryza sativa (japonica cultivar-group)] >gi|40253523|dbj|BAD05471.1| putative GDP-mannose pyrophosphorylase [Oryza sativa Japonica Group] >gi|113623289|dbj|BAF23234.1| Os08g0237200 [Oryza sativa (japonica cultivar-group)] >gi|125560667|gb|EAZ06115.1| hypothetical protein OsI_28352 [Oryza sativa Indica Group] >gi|125572627|gb|EAZ14142.1| hypothetical protein OsJ_003967 [Oryza sativa (japonica cultivar-group)] >gi|215769178|dbj|BAH01407.1| unnamed protein product [Oryza sativa Japonica Group]
Score 911
Evalue 2.06292e-96
Total Hit Count 500
Registered year 2002
Contig Sequence     [ Download ]
>Contig9302
ttttttttttaAAGCTGGAAgtcGATCTTAATGGGAAACAACACTGGGAATGACTAATGCACATACACTCTCATCAGTTTAACAAGTCTCGCAAGTTCCA
CATATATTAAGCTGTTTACAGTATGCACTAGAACAAAGACGCCACACAACATCGTTCCTAAAAGCATTTGTGAGCGGTGAGCTCACATGACGATCTCAGG
CTTCAGGATGCTTGACTTGATCTCCTTGTGTGGGAGAACAACACCGCCGTTGCTGTAGACCTCGTCACCTACATGTACGTCTTCTCCCAGGATAGTCATA
TTCTCTATGCGTGCCCATTGTCCAACCGTCGAATGCCAGCCGATAATGCTGTTTGAGATGCACGCATGCTTCTTAATGCGCACACCGCGCATCACCGTGC
ATCGGGAGAGCCtcacaccatcctccacgacgcatccaggtccaatagcaacatcaggaccaatcaggcaaccctccccaatcttggcgctctcgtgcac
caggacgttcccaacaacatgtgctccagcggccagcttggcagctgatttcttcctaagtgaatctaggtagagacgcaagccagtgatgtagtccctt
ggctggccaatatccatccaaaagcctggaaggaccatggcgtagagcttctgatcagctgcaattcgagggaagacctccttctcgattgaagttggct
ttaactcgatgcggtccagcacagacggatttaacaagtaaattcctgcattgatcttg
page-top