Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9209  (registered. 2002)
Contig Information
Length 1095 bp
Clones 4 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit PREDICTED: similar to Notch4 [Monodelphis domestica]
Score 90
Evalue 0.610049
Total Hit Count 4
Registered year 2002
Contig Sequence     [ Download ]
>Contig9209
ggggtTCCCAGCCCcatctt*ctCCGCCGCCGCCATGTAATCCTCTCCGACCTCGCCtgg*agCAGCCAGCAAGATGCCGCCGCCGTGGCCGCCTCTCTC
CCTTCTCTCCTCTTTTTCCCTACCTTTCTCTCTCCTCTAAAGTCTAAACTGTGTGCAGGTCCTCTCCACAGGTGCTGCCATGGCCGTGTCATGGAGCTCG
CCCCCGTGGGATGCATGCCCCTCCAATGACGCCCTGTCCAGGTCCTCTGGATCCCGATTTGAGTGTGTTATTTTGCGTCCGATCCTGATTTGGACGGCAT
TTTTTGAGGCACCGCGAGCGCGCTGGACGGCAAAAAGGGTTGCGTCAAGGAGCGACGCATTGTTGTAAGCCTGTAGCACACCATTGTTGCTACTCCCACC
TCGATGGTCTATCTCATGGGTTGCAGATAGGATGTGATATTCTGCAGCGTGGACATCGCCTAGCAATCAGATTTGATGTTGAGAAAGATCCGGCAGGAAG
ATCTCATCCTGGAACCCAGGAGTGCTTGATTTGATATTGAGAATTCTACTTGCTAGCAGTGTACATGTTTCTTATGATGCCCGTGTGCGTTTACCTTGTC
AAGAAGTTCCGCGTGAATGTCAATGCCGATGAAGACAAAGGTGCTCTGCTTCGATCCCTTCTTTTGATTTCGCAAAATGGAAAACACAAGGGTGTCTGGA
AATTGAGATCGTTGGTTCACCATCAGAAGCTTCGCATGAACGTCAATGTCGATAATGACAAAGGACAGACAAAGAAGAAGGTTAGGGAGGACATGCCCGA
GAAGCTCAGAGATAAGGCAGAGGTTGGGGACACATAGGGGAAGCCTTGAAGGGGGAGATAAGCAAGCTCAAGCACTATGAGCATGGGATGACAGAGCGGC
CGACCAAGGCGGTTGAGAGCAGGCGTGTGCGAGAGGAAGTGAACTGGGGAGAGGCAACAGGGGGCATCACTAGGAAGGCAGCAGGTGGCATGCAACATTG
GCCTTATCTCTTATGTTCGCCAAGGTGGCCTGTTGTTTCCACAATATGTTTGGATTGTCATGTTGTtatggtCACGTAGGgttaaatTCTTTcaa
page-top